Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16123  (registered. 2007)
Contig Information
Length 1394 bp
Clones 57 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_e Seed DPA10 54
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0104800 [Oryza sativa (japonica cultivar-group)] >gi|46359906|gb|AAS88838.1| putative 26S proteasome regulatory subunit [Oryza sativa (japonica cultivar-group)] >gi|52353598|gb|AAU44164.1| putative 26S proteasome regulatory subunit [Oryza sativa (japonica cultivar-group)] >gi|113577956|dbj|BAF16319.1| Os05g0104800 [Oryza sativa (japonica cultivar-group)] >gi|125550510|gb|EAY96219.1| hypothetical protein OsI_18108 [Oryza sativa Indica Group] >gi|125592515|gb|EAZ32574.1| hypothetical protein OsJ_016057 [Oryza sativa (japonica cultivar-group)] >gi|215679365|dbj|BAG96505.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215687270|dbj|BAG91835.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737651|dbj|BAG96781.1| unnamed protein product [Oryza sativa Japonica Group]
Score 353
Evalue 2.68118e-31
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16123
aagctgaacaccgcgatctgagtccgtgtgatgcttgacaggtataccagcgcaagattgtcctgaatcttgtcattgaagagcctgtcaaaagatgctg
gagacagctttggcatggaggagacggtgtcagcaatgaacctgcctatcttgttgtccggtgccacacgagcttcgacaacatcatcaacatatttgta
gatctcgtcaataagagcatatagcttttgcattgaagactccatccttcacaCAACTAGAGCACAAGCATCAAATCCA*GTAGGTAGTAGTTAACGCAA
ATCCACCATG*AAGACCTTACTCATCCTGACAATCCTTGCGATGGCAATAACCATCGCCACCGCCAATATGCAGGCCGACCCTAGCGGCCAAGTACAATG
GCCGCAACAACAACCATTCCTGCAGCCTCACCAACCATTCTCCCAGCAACCACAACAAATATTTCCCCAACCCCAACAAACATTCCCCCATCAACCACAA
CAACAAT*TTCCCCAGCCTCAGCAACCACAACAACAATTTCTCCAGCCCCGACAACCATTCCCCCAACAACCACAACAACCATATCCCCAGCAACCACAA
CAACCGTTCCCCCAG*ACTCAACAACCCCAACAACCATTTCCCCAGTCCAAGCAACCACAA*CAACCTTTTCCCCAGCCCCAACAACCG*CAACAA*TCA
TTCCCCCAACAACAACCAT*CGTTGATTCAACAATCTCTACAACAA*CAGTTGAACCCATGCAAGAATTTCCTCTTGCAGCAATGCAAACCTGTGT*CCT
TGGTGTCATCCCTCTGGTCAATCATCTTGCCACCAAG*CGATTGCCAGGTGATGCGGCAACAATGTTGTCAACAACTAGCACAAATTCCT*CAGCAACTC
CA*GTGTGCAGCCAT*CCATAGCGTCGTGCATTCCATCATCATGCAGCAAGAACAACAAGAACAACTACAGGGTGTGCAAATCCTGGTGCCACTGTCTCA
ACAGCAACAGGTGGGTCAAGGTATTCTCGTCCAGGGTCAAGGCATCATCCAACCTCAACAACCAGCTCAATTGGAGGTGATCAGGTCATTGGTGTTGCAA
ACTCTTCCAACCATGTGCAACGTGTATGTCCCACCTTACTGCTCCACCATCAGGGCACCATTTGCTAGCATAGTCGCCAGCATTGGTGGCCAATGAAAAA
AAA*CAAGAGCTATTCTAAAAGTTAGATGGCCATCGTTGCTTAGCTTATGCACCAATCGATGTAACGATGACAAATAAAGTGGCGTGCACCATCATGTGT
GAT*CCTG*ACCAAGTGCTAGTTCAAG*ATTGGAAATAAAAGACAAACTCAGTCCTTGTTTGCCAGCATTGCCTGTCATTGTtcaaaaaaaaaa
page-top