Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16122  (registered. 2007)
Contig Information
Length 982 bp
Clones 57 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 8
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 7
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 8
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 8
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0565000 [Oryza sativa (japonica cultivar-group)] >gi|33146750|dbj|BAC79661.1| putative 40S ribosomal protein S11 [Oryza sativa Japonica Group] >gi|50508298|dbj|BAD30107.1| putative 40S ribosomal protein S11 [Oryza sativa Japonica Group] >gi|113611543|dbj|BAF21921.1| Os07g0565000 [Oryza sativa (japonica cultivar-group)] >gi|215768067|dbj|BAH00296.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195559|gb|EEC77986.1| hypothetical protein OsI_17372 [Oryza sativa Indica Group]
Score 731
Evalue 2.34869e-75
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16122
ggggcggtacaacagcaactagggtgcaaaccagtgagaccgagtgaaactcaaggacaactcaacttgtgacgatctcaagtcaaatctcaagctaaat
gagacggtaaaaaatatataatatatggacattcagaataggaacaagacaacAATGCTCCGGTAAAGATCATATCGCATCTGGGCAAAACAAATTCAGC
ACCAAAGAAAAAACTG*ACCGTACAATTTTAAG*CAAAACTATTAATGATAGATAGATTCCACAAGACATGTTCAGATCACGACATTCTTCGGTTTGACA
G*AAAACACAGG*AATCAAATCGCAAAACAGCAGCAGCCTGGTAGGTTTAAGTGCTTAAAACGTCTGACTATGAACTACTCATGAATCAGAGCCTGGGCT
TAAGCAGCGATGAAAGCCTTCTTCCCGCCTCCGGTGGTTCCAGCTGGAACAACCTTCAGGACATTGAATCTCACGGTTTTCGACAGGGGCCTGCACTGGC
CAATGATGACATGGTCGCCTTCCTTGACTCGGAAGCAGGGGGAGATGTGAGCTGGGATGTTGGA*GTGCCTCTTCTCATACCTCTGATACTTCTTCACAA
AATGAAGGTAGTTCCTGCGAACAATGATGGTCCTGTTCATCTTGGCACTGTGGCAGGTTCCAGCTATGATTCTGCCCCTGATGGCAACAGTTCCAGTGAA
TGGGCACTTCTTGTCAATGTAGGTACCATCGATCGCTTCCCTTGGGG*TCTTGAAACCAAGGCCAACACTCTTCCAGAAGCGGTTGCCAGCCTTGCCTGG
CCT*CTTGGCCTTGTCGGCCTTTTT*CGTGCTGAGGAAAACCTTTGGCTGCTTGAGGAAAGACTT*CTCGGTCTGCT*CCGCCATGGCTG*CG*AGGTGG
G*CGTCGAGGGG*CTCGGAGGCGGCGGCGGCGGCGCGT*CGAGGGGAAGCGGGAGCAAGGCT*CTGAGAGCCtcgtgccgaa
page-top