Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16119  (registered. 2007)
Contig Information
Length 911 bp
Clones 56 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 10
Wh_dL Crown of seedling 5
Wh_yd Spikelet at late flowering 12
Wh_yf Spikelet at early flowering 29
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0569200 [Oryza sativa (japonica cultivar-group)] >gi|77556849|gb|ABA99645.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113649578|dbj|BAF30090.1| Os12g0569200 [Oryza sativa (japonica cultivar-group)]
Score 261
Evalue 8.7061e-28
Total Hit Count 11
Registered year 2007
Contig Sequence     [ Download ]
>Contig16119
gctcaaactgccgaacACAACACAACCAACAAAGcaaatccaGCTAGTACTTAATTTAGGCGCGTAG*AAATAAGATCGGTACTTATATGTCGGACCAAC
AAGTCACGACACGCAAACATTTGCATTTGAGCTAAGCCCAT*ACTACAT*CC*ATG*CAAACACAGC*TAGTTAAACTGCAAATCCGACACTAGTAAACA
CGA*CTGACGACGG*TACAATCTACTGGTACCTCGTTGGAACACACACACAACAGATTAACCAGAAACAGCTGCAACATTATTCAACACTACTAAGCAGG
TGCGGCAGCTAGCTAGGCGGGCA*ATGGATGGATCGATCTATGGGTTGTAGTAGACGATCTTGATCTCGGTGACGCCGTGGCAGTTGCCGCCGGGGACGG
AGTGCTCGAAGCAGTGGTTGCC*GCTGTTGCATCCGGCGGTGGGGCAGTGCCCCTGCAGCGGGC*T*GCCGTGCGGGGTGACGGAGACGCGGATGGGCAT
GTTGGCCTGGTCGGTGCTCACCTCGTAGTACGCCCCGCCCGTCGTGGCCCGATGTGGAACTTGGCCACGGCGGCGCCCTGCGCCGACACGCTCCCGGACC
AGGAGCACACGTCGAACGACTCGTGCTT*CCCGTTGGGGAGCAGCCAGCCGTTGGGGAAGAGGACCTT*GCTGTCCGCCACCGCCGCGATACCCAGGTTC
AGATCGTGGCCGCACAGGTTCTGCACCGTCACCTTGTGGCCGCCGCAGCCTTGACCGGCGGCAGACATGG*CCGTCGCGGACAGAGTCACGAGCAGCAGG
AGGGCAAGGGG*CTTGGAGGCCGCCATTGAGTAGCTATCAGTATGGTG*CTATGACTAGGGAATCGAggaagaagaggc***cctcgtgccgaattncct
gcagacccggg
page-top