Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16118  (registered. 2007)
Contig Information
Length 796 bp
Clones 56 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 11
Wh_dL Crown of seedling 7
Wh_e Seed DPA10 10
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 11
Wh_r Root 2
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0284600 [Oryza sativa (japonica cultivar-group)] >gi|47847708|dbj|BAD21487.1| putative 60S ribosomal protein L27 [Oryza sativa Japonica Group] >gi|47848339|dbj|BAD22201.1| putative 60S ribosomal protein L27 [Oryza sativa Japonica Group] >gi|113536101|dbj|BAF08484.1| Os02g0284600 [Oryza sativa (japonica cultivar-group)] >gi|125538995|gb|EAY85390.1| hypothetical protein OsI_06769 [Oryza sativa Indica Group] >gi|125581675|gb|EAZ22606.1| hypothetical protein OsJ_006089 [Oryza sativa (japonica cultivar-group)] >gi|215768337|dbj|BAH00566.1| unnamed protein product [Oryza sativa Japonica Group]
Score 584
Evalue 1.7784e-58
Total Hit Count 313
Registered year 2007
Contig Sequence     [ Download ]
>Contig16118
gggctgaggaattcggcacgcgggacccctcccCT*CCCCTCCCCTCCCCCAACCCACCGG*CGGCGGCGCAGCGCAGCTTG*AGG*AAGGAAGCGAAGA
TGGTGAAGTTCCTGAAGCCCGGCAAGGCGGTGATCCTGCTGCAGGGCAGGTAC*GCGGGG*AAGAAGGCGGTGATCGTGCGCGTGTTCGAGGAGGGCACC
CGCGACCGCCCGTACGGGCACTGCCTCGTCGCCGGGCTGGCCAAGTACCCGAA*GAAGGTGATCCGCAAGGACTCGGCCAAGAAGACGGCCAAGAAGTCC
CGCGTCAAGGTGTTCCTCAAGCTCGTCAACTTCACCCATCTCATGCCCACCCGCTATACCCTCGACGTC*GACCTCAAGG*AGGTGGCCTCCGGCGCGCC
CGACTCCCTCACCTCCAAGGACAAGAAGGTGGGCGCCGCCAAGGCCGCCAAGGCCAAGCTCGAGGAGAGGTTCAAGACCGGCAAGAACAGGTGGTTCTTC
ACCAAGCTCCGCTTCTAGGCCGGCCGGCCGCGCCAGGGCGGTCTCTGCCGTTATTACTACCCGAACCCTTTACATTTTTAGTTGCTTGTTATCGGTGACT
GTTGCTGCGCTTAAGGTGTCCTGTTTTGGTATTGCCCATGAAGAAGACT*CTGTGTTTAGCTTGG*AT*C*TTATGAG*ATATG*ATGA*TGTTT*CATG
TGTTAAA*T*CATGTG*AAGAATAGAT*CTTTGTTGGAATTTTGTTCAGTGTTATTACTTCTTGAGATATGCTGTCTgttgcgtccnnatattatt
page-top