Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16105  (registered. 2007)
Contig Information
Length 680 bp
Clones 53 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 15
Wh_SL Seed DPA30 5
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 11
Wh_h Spike at heading date 2
Wh_r Root 8
Wh_yd Spikelet at late flowering 9
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 198
Evalue 7.25994e-14
Total Hit Count 55
Registered year 2007
Contig Sequence     [ Download ]
>Contig16105
ttttttttttcagaaaaccaaaaccaggtTTGACACAGCAAGGTAGAAGGCAAACAATGAATTAGACACACCAACTTTTGAG*ATGAAGACGATTAGTTT
GAAAGCGACAGGTTTTAGGCAAGC*TGGCTTCCAAG*CAGG*AGGTCAGC*CTGG*ACACAA*TG*AACCATACAG*ACAG*AGTACATCGACGCAGG*T
GGTAAACTGCTGAAACCAAACACTTCCAGTTTTCACCACATGG*ATAACAG*AGATACAGGCCAATTCATCGCAGCATCATTAACAG*AG*ATCACTTCC
CGCCAAACAAG*TAGCCCAGGG*ACGAG*CCACCGCCGGGAGCAGCATGAACCTTGG*TTGAAGGACGGTCCGTAAGGAAGTTGCCCGTGTTCTGGCCAT
CTGCACGGTAGTAGTTGTTCGCCCGGCTACCTGGAATGCCA*GCTGGAATCTGCTTGGTTACATCGGCAGCTGCCAGTGCTGGTTTCTCAGCAGGTGCTG
GCTTCGCAGCTGGTGCTGCAGCAGGCTTTGCAGGCTCACCATCTCCAAACAGGTAACCCAGAGAACTTTGACCACCT*CCAGCACT*CCCGCCACGACTC
AT*CTT*GACTTAGATCGGGCGCCGACGAGGGGACGGGGGACGGGGGACGAGGACGAGACAGGAGGAGGCG*CTCGAAgc
page-top