Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16104  (registered. 2007)
Contig Information
Length 937 bp
Clones 53 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 9
Wh_dL Crown of seedling 12
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 4
Wh_r Root 5
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0160200 [Oryza sativa (japonica cultivar-group)] >gi|113578271|dbj|BAF16634.1| Os05g0160200 [Oryza sativa (japonica cultivar-group)]
Score 638
Evalue 1.33474e-64
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16104
aaatagtcgtcatccacatgtaagccctgcatagctattgactaatctacaaacacctgccataaaggttataagccaaagAACACATGTATCAACAGGA
TACATTTTTCGTGATCCCACCACCTTATTAAGATCAGcaacagcatagaataacgaAAGCCGACATGGGATAGATTAAAAGCATTTGGACTGATAGCATA
CGGACACCAAAATTTAAG*CACGCATCGCACTACA*G*CAGTATGCGATGAAATATT*CAGG*AAACATG*ATACTCAAGGTTTCAGTTTAAAAG*ACAA
ACGGG*ACACATCTAAATGAGTTCGATTCTCGATAGGTAGGTAAAAAGAGCAGAGCAAACGCGA*GCCACCTCTAAGCCTTCTGGTTGTAGACGTAGGTG
AGGCCGCACTTGCCGCAGTAGTGGCGGTCGAAGTGGTTGGCCATGAAGGTGCCGGCGCCGCAGTCGGCGTTGGGGCACTCCTTCCTGAGCCTGGTCACCT
TGCCGGTGGCGTCGTCGACCTTGTAGAACTGGAGGACGGCGAGCTTCACCTTCTTGTGCTTGTGCTTTTGCTTCTTGGGCTTGGTGTAGGTCTTCTTCTT
GCGCTTCTTGGCGCCGCCGCGGAGGCGGAGCACCAGGTGGAGGGTGG*ACTCCTTCTGGATGTTGTAGTCGG*CGAGGGTGCGGCCGTCCTCGAGCTGCT
TACCGGCGAAGATGAGGCGCTGCTGGT*CCGGCGGGATGCCCTCCTTGTCCTGGATCTTGGCCTTGACGTTGTCGATGGTGTCCGAGGACTCCACCTCCA
GCGTGATGGT*CTTGCCCGTCAGGGT*CTTCACGAAGATCTGCATCTTGGCGGCGGTGCCGAGGTCGCCTCCGCGCGCTGCGGCGGCGACGGCGGCGGCG
GGGTAGGGTTTGGGTTAGGGGGCCCTCGTGCCGAatt
page-top