Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16102  (registered. 2007)
Contig Information
Length 896 bp
Clones 53 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 7
Wh_SL Seed DPA30 13
Wh_dL Crown of seedling 14
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 8
Wh_oh Pistil at heading date 5
Wh_r Root 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0565000 [Oryza sativa (japonica cultivar-group)] >gi|50511482|gb|AAT77404.1| putative 60S ribosomal protein L18a [Oryza sativa (japonica cultivar-group)] >gi|113579886|dbj|BAF18249.1| Os05g0565000 [Oryza sativa (japonica cultivar-group)] >gi|125553330|gb|EAY99039.1| hypothetical protein OsI_20997 [Oryza sativa Indica Group] >gi|125595234|gb|EAZ35293.1| hypothetical protein OsJ_018776 [Oryza sativa (japonica cultivar-group)] >gi|215734942|dbj|BAG95664.1| unnamed protein product [Oryza sativa Japonica Group]
Score 898
Evalue 8.54577e-95
Total Hit Count 303
Registered year 2007
Contig Sequence     [ Download ]
>Contig16102
ttcggcacgagg*aTCTCCTTAGGTTTCAGTTCTCCTCCGCCTCCGGTCTCGAG*AGCTCGCCAG*AATGGTCGCCCACAGGTTCCACCAGTA*CCAGGT
GGTGGGTCGCGCGCTGCCGGCCCCCGGCGATGAGCAGCCCAAG*ATCTACCGCATGAAGCTCTGGGCCACCAATGAGGTCC*GCGCCAAGTCCAAGTTC*
TGGTACTTCCTGAGGAAGCTCAAGAAGGTGAAGAAGGCCAACGG*C*CAGA*TGCTCGCCATCAACGAGATCTTTGAGAAGAACCCCACCACAATCAAGA
ACTACGG*CATCTGGCTGAGGTACCAGAGCAGGACCGGTTACCACAA*CATGTACAAGGAGTACCGTGACACGACCCTCAACGGCGGGGTGGAGCAGATG
TACACGGAGA*TGGCGTCGCGGCACCGCGTGCGTGCCCCCT*GCATCCAGATCATCAAGACTGCGACGGTGGACTTCAAGCTGTGCAAGAGGGACAACAC
GAAGCAGTTCCACAACT*CGAAGATCAAGTTCCCGCT*GGTGTACCAG*AAGGTTCGCCCACCCACCCGCAAGCTCAAGACCACCTACAAGGCGACGAGG
CCCAACCTCTT*CATGTGAGCGGGTCCCTACT*CTACTGGCCTGTGTGTTTTAGCGTGTAAGAGTTTGAAGATTTTTGCATGTGG*AAGTTTTGGTTAAG
CACTTAGATGATGTTTT*CGGTCGCTAAGGATGCTGCTG*CTTTGATGCAACT*CTTGACTTTGTTTG*GTATTAGTAATGCGCAGCAGATCCATCAACT
GCTAGCCCTCAGCTGCtatgttttggtttggtctgctttcaaatgcagtcgacaagtctgatgcctaaattattccgtgcgcccaccctttagggc
page-top