Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16100  (registered. 2007)
Contig Information
Length 1562 bp
Clones 52 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 7
Wh_e Seed DPA10 6
Wh_f Spike at flowering date 10
Wh_h Spike at heading date 7
Wh_oh Pistil at heading date 3
Wh_r Root 10
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0654500 [Oryza sativa (japonica cultivar-group)] >gi|5007084|gb|AAD37809.1|AF155333_1 NADP-specific isocitrate dehydrogenase [Oryza sativa] >gi|20161528|dbj|BAB90451.1| putative NADP-specific isocitrate dehydrogenase [Oryza sativa Japonica Group] >gi|55773928|dbj|BAD72316.1| putative NADP-specific isocitrate dehydrogenase [Oryza sativa Japonica Group] >gi|113533280|dbj|BAF05663.1| Os01g0654500 [Oryza sativa (japonica cultivar-group)] >gi|125527107|gb|EAY75221.1| hypothetical protein OsI_03110 [Oryza sativa Indica Group] >gi|125571425|gb|EAZ12940.1| hypothetical protein OsJ_002765 [Oryza sativa (japonica cultivar-group)] >gi|169244431|gb|ACA50489.1| NADP-specific isocitrate dehydrogenase [Oryza sativa Japonica Group] >gi|215692671|dbj|BAG88091.1| unnamed protein product [Oryza sativa Japonica Group]
Score 2022
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16100
ctgcaggnaatTCGGCACGaggCACAGCCGCCGCCTCCCCCACCAACCTGCCCCGATCCGCTCCCGACCTCCGAGGCAATCAGCGTCCGCCGCGGCCGCC
ATGGCGTTCGAGAAGATCAAGGTCGCCAACCCCATCGTCGAGATGGACGGCGATGAGATGACCAGAGTATTCTGGCAGTCTATCAAGGACAAGCTTATCT
TCCCATTTTTGGACTTGGACATTAAGTACTTTGACTTGGGAGTTCTACACCGCGATGCAACTGATGACAAGGTTACAGTGGAGGCTGCAGAGGCTACTCT
CAAGTACAATGTGGCTATTAAATGTGCAACTATTACTCCAGATGAAGATCGGGTTAAGGAGTTCAACCTAAAACAAATGTGGAGGAGCCCAAATGGCACA
ATTAGGAACATTATAAACGGCACCGTGTTCAGAGAGCCAATTATATGCAA*GAATGTCCCAAAGCTTGTTCCAGGATGGACTAAGCCCATCTGCATTGGA
AGGCATGCTTTCGGTGATCAGTACAGAGCAACTGATGCA*GTTCTCAAGGGACCTGGCAAACTCAGACTAGTGTTCGAGGGAAAAGACGAGACGGTTGAC
CTTGAGGTTTTTAACTTCACTGGTGCTGGAGGAGTCGCCATGGCTATGTACAACACAGATGAGTCAATTCGAGGTTTTGCTGAAGCTTCTATGGCAATCG
CTTATGAGAAGAAATGGCCATTGTACCTTAGCACAAAAAACACAATCCTTAAGAAATATGATGGCAGGTTCAAGGACATTTTCCAGGAGATCTATGAAGC
TGGCTGGAAATCCAAATATGAGGCTGCTGGAATATGGTATGAACATCGTCTCATTGATGACATGGTTGCCTATGCACTTAAGAGCGAAGGAGG*CTATGT
TTGGGCTTGCAAGAA*CTATGACGGAGATGTGCAGAGTGATTTCTTAGCTCAAGGTTTTGGCTCTTTGGGCTTGATGACGTCA*G*TATT*GATGTGCCC
TGATGGTAAAACCATCGAAGCTGAAGCTGCCCATGGCACAGTTACCCGCCATTTCCGTGTTCACCAGAAAGGTGGTGAAACCAGCACAAACAGCATTGCT
TCAATCTTTGCTTGGACAAGAGGACTTGCACACAGGGCAAAGCTAGACGAGAATGCTAGACTTCTTGAATTTGCACAGAAACTTGAGGAAGCGTGCGTCG
GAACTGTGGAGTCTGGGAAGATGACCAAGGACCTTGCACTCCTTGTCCATGGATCCTCAAAAGTTACAAGAAGCGATTACCTGAACACTGAAGAGTTCAT
TGACGCTGTTGCTGCTGAGCTCAAATCAAGACTGTGAAAGACCTCTTCCACTTCAATGCTTGAATAGTCATTACTCATCGATTCAAGTCATTTTGGTTAT
GTCGCCATTACCTGTCATGCTTTCATTGTGAACAGAACGAGCTTTTACTGCACCATCGCATATTATTGTCAAACATGCAAGCGATT*CTGTAGATGCTG*
ATGTTATGTAAGTGGGG*CTCACAATAAAGGACATATAGAACCATTATTCAcaaaaaaaaaa
page-top