Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16094  (registered. 2007)
Contig Information
Length 690 bp
Clones 51 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 8
Wh_SL Seed DPA30 8
Wh_dL Crown of seedling 14
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 3
Wh_r Root 2
Wh_yd Spikelet at late flowering 8
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100193910 [Zea mays] >gi|194694430|gb|ACF81299.1| unknown [Zea mays] >gi|195605368|gb|ACG24514.1| 60S ribosomal protein L34 [Zea mays] >gi|195605588|gb|ACG24624.1| 60S ribosomal protein L34 [Zea mays] >gi|195611046|gb|ACG27353.1| 60S ribosomal protein L34 [Zea mays]
Score 381
Evalue 1.3788e-42
Total Hit Count 309
Registered year 2007
Contig Sequence     [ Download ]
>Contig16094
ttttttttttgAAACCAAATTAACATAAGTAGATTCAACATGCATTCAGAAATG*AAACTGCAAATGGGTATCAAATGTTTCACAATCTCTGATGTCACG
GCGG*CAGAAGGATTTCAAGTACTCTAAAACATTTAGCTAGAAGGGACTAAACCATTGATCATAACCACCAACAAAAATATTTTCCTTGTTTACAGAACA
CCAT*CGCACTTCGCACTTCTGTTTCAAACAGATTACTTTGAGGTCGTCTTGTCCTTGGTCTTCTGTATTTTCAACACCTTCTTCACGATCTTCTGCTCC
TCAACCAAGAAAGCGCGGATGATCCTTTCCCTCACCGCAGTTCCAGAGAGCACTCCACCATAGGGACGGTTCACAGTCCTGCGGTTCCTAGACAACCTTG
ATCTTTTGTATTCAGTAGGCC*T*GAGGTGGGGAATCCCCTGGATCTTCTTCCCGGTCACAGGGCACTTGGGGCCGCTCGCCCTCTTCTTGGTGTAC*TG
GTACACGAGCTTACCACC*T*GGGGT*CTTGACGACCCCGCGTCTGGTTGGACTTGGTGGCATAGC*TGTGCCTCTT*CC*GGTAGG*TCAGACGCTGCA
CCATGTTTCC*GTCGT*CTCCGCCGCCGGCAGTAGGGGGCTTGCGCAAAGAGTGGGGAGAGAGAGAGGAGAGCGAgccctcgtgccgaat
page-top