Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16084  (registered. 2007)
Contig Information
Length 924 bp
Clones 50 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 9
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 5
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 6
Wh_r Root 4
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0478200 [Oryza sativa (japonica cultivar-group)] >gi|32352148|dbj|BAC78567.1| hypothetical protein [Oryza sativa Japonica Group] >gi|42407865|dbj|BAD09007.1| putative mitochondrial F0 ATP synthase D chain [Oryza sativa Japonica Group] >gi|113624019|dbj|BAF23964.1| Os08g0478200 [Oryza sativa (japonica cultivar-group)] >gi|215695541|dbj|BAG90732.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218201320|gb|EEC83747.1| hypothetical protein OsI_29610 [Oryza sativa Indica Group]
Score 783
Evalue 1.99043e-81
Total Hit Count 325
Registered year 2007
Contig Sequence     [ Download ]
>Contig16084
caATCAAG*AGACACACA*CAGGTCTAGCAGATCCAGAGCCGAAGATGAGCGGGGTGAAG*AAGGTGACGG*ACGTTGCGGCCAAGG*CCGGG*AAGGCG
ATCGACTGGG*ACGGCCTGGCCAAG*ATGCTCGTCTCCGACGAGGCCCGGAAGGAGTTCGCCAACCTCC*GCCGCACCTTCGAGGACGTCAACCACCAGC
TCCAGACCAAGTTCTCCCAGGAACCAAA*GCCAATTGACTGGGAATACTACAAAAAGGGAATCGGATCGAAAGTTGTGGATATGTACAAGGAGGCTTATG
ATAGCATTGAGATCCCAAAGTATGTTGACACTGTCACTCCTGAGTACAAGCCAAAGTTTGATGCTCTGTTAATTGAAATGAAGGAAGCAGAGAAGACATC
TCTGAAGGAATCAGAGAGGATAGAGAAGGAGATTGCTGAATTGAAAGAGATGAAGAAAAAGATCAGCACAATGACAGCAGACGAGTACTTTGCGAAGCAC
CCTGAACTCAAGAAGAAGTTTGATGATGAGATCCGTAACGATTACTGGGGATACTAGATAACGGCGAAAGTCCAAGTTCTTTTACTAGAACATGCAATAA
TACTTATTTGTCCCTCTGGAATCTCATCATCCATAC*TT*GGGTGAATTCCATAACATGTGGACTGGG*C*TTGTTGAAATTCCAACATAACTCTTAT*C
TTTGTGCTTTCTGTTGGACCTCATCATTTTAAGGGTTGCCAG*CTTATTTCAATGAAATTTTGTCTctttaacttctgctcctttgtacaagaggatttc
tgctatggctcgattcctccatgtaccttgttgtttgtcaatgtgctcatccttgatagacaccgatctttaggctgggagaggagttaacctaacatgt
gacatgtctgtaacaaaaaaaaaa
page-top