Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16066  (registered. 2007)
Contig Information
Length 830 bp
Clones 48 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 9
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 7
Wh_h Spike at heading date 4
Wh_r Root 3
Wh_yd Spikelet at late flowering 7
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_005797 [Oryza sativa (japonica cultivar-group)]
Score 395
Evalue 9.99933e-48
Total Hit Count 318
Registered year 2007
Contig Sequence     [ Download ]
>Contig16066
ctaaaaaagagatccgctagagttgctccaatgacacctaaacagaacttgaaatcgctcgtaagaaatcattccattgcgcaacATGGAAACATTCAAG
GGGAAAATAACCCACAATGAATTTTGACTGATCAACAGCCGAAACCAAG*AA*CAACGACAACCAGGTGTATAACAAGTTCCTCAAAATCATAGCATAAG
ATACTACAAAA*TGCC*TCTTAACATACCAGG*AG*ATGACATAAATGATAAAGTCTTTTCTAGTTATAATTAAGCACTCAGCAACATTGCAACAGGGAT
ACCGTCCTAAACCAAGGACAGGCCCTTACTTCTTCTTCGCATCTCCGGCCTTGGTCTTCTTCACACCACGGATCTTCTTGGTCCTGTTTTTCCTTTCCTT
GATCTGCTTTCGTGACTTCTCCACCTTTGTAGCAAGACCGTTCCTGATGAGGCGGTACTTGGGCTCGAACTTCTTGGCGGACTCGAGGTTGTCGTAGATG
AGACCAAACCCGGAGGACTTGCCGCCTCCGAAGTGGGTGCGGAACTTGAACACGAAGATGCAGTTGGGGTCCTTGACCTCGTACACCTTGGCGAGCCTCT
CCTTGAGCTCCGCCTTGGA*GACGTTGGCGCGGCCCGGGGTGGATGACCTCGAGCACGAACTGCTTGCGGGCGAGCAGGCGGTTGGTCATGAACTTGCGG
GTGCGGAGGGTGACCCGCCGTGGTGGT*CTT*GGCGTCCGCCATGGCTGATTCGACCTCGCTT*CGCGGTGG*GCTGACTGCGGA*GGAGGTGGCGGCGG
CGGCGGCGGCGCGAGGGGGAGGAAAGCGgc
page-top