Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16064  (registered. 2007)
Contig Information
Length 1607 bp
Clones 48 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 7
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 12
Wh_e Seed DPA10 4
Wh_h Spike at heading date 5
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 2273
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16064
ttttttttttAATGGGATGAGAGCACAATAATGGAATC*GAAATAGAGTATTTAAACGACACATCATAGCTCGCACACAGGTGCAGG*AGTCAAAGTGCA
ACAACGCCCAGG*AATAACACTTAACATACACTAAGATTCTCCAAAAAAGACTTGACACTAAAACTTCTGCTAGATAACTCGATGGCAGACACCAGAGCA
CTCATTTCTTCTTGATGGCAGCCTTGGTAACCTTGGCACCGGTGGGGTCCTTCTTCTCCACGCCCTTGATGACACCAACAGCAACCGTTTGTCTCATATC
ACGCACAGCAAAGCGGCCAAGAGGAGGGTAGGTGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACC*GGCGTCACCATTCTT
GAGGAACTTGGGCAGCGCCTCCAGCTCCTTACCAGATCGCCTGTCGATCTTGGTCACCAGCTCAGCAAACTTGACAGCAATGTGGGAGGTGTGGCAGTCC
AGCACTGGGGCATAGCCGTTACCGATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCCGCCTCCTTGGCAGGGTCATCCTTGGAGT
TGGATGCAACAAACCCACGCTTCAGATCCTTAACAGCAACGTTCTTGACATTGAAGCC*GACGTTGTCACCAGGAAGCGCCTCCAGCAGAGACTCGTGGT
GCATCTCAACAGACTTGACCTCAGTTGTCAGACCAGTGGGACCAAAGGTAACAACCATACCAGGCTTGATGACACCAGTCTCAACACGGCCAACAGGCAC
AGTTCCAATGCCACCAATCTTGTAAACATCCTGAAGGGGAAGACGCAGGGGCTTGTCTGAGGGCCTCTTGGGCTCGTTGATCTGGTCAAGAGCCTCAAGA
AGGGTAGGGCCCTTGTACCAGTCAAGGTTGGTGGACCTCTCAATCATGTTGTCACCCTCAAACCCAGAGATGGGGACGAAGGGAACCTTGTCAGGGTTGT
AGCCAACCTTCTTCAGGTACGAAGAGACTTCCTTGACAATTTCCTCATAACGAGCCTTCGAGTACTTAGGAGTGGTGGCATCCATCTTGTTGCAGCAGCA
GATCATCTGCTTCACTCCAAGAGTGAAAGCAAGGAGGGCGTGCTCACGGGTCTGGCCATCCTTGGAGATACCAGCCTCAAAACCACCAGTGGTGGAGTCA
ATGATGAGCACAGCACAGTCAGCCTGGGAGGTACCAGTAATCATGTTCTTGATGAAGTCACGGTGACCAGGGGCATCAATGACGGTGCAGTAGTACTTGG
TGGTCTCGAACTTCCACAGGGCAATATCAATGGTGATACCCCTCTCACGCTCGGCCTTCAGCTTGTCAAGCACCCAGGCGTACTTGAACGACCGCTTGTT
CATCTCAGCGGCTTCCTTCTCGAACCTCTCGATCACACGCTTGTCAATACCTCCAAGCTTGTAGATCAGATGGCCAGTGGTGGTCGACTTGCCGGAGTCG
ACATGGCCAATGACCACGATGTTGATGTGAGTCTTCTCCTTACCCATGGCTGAAactcgaaggaagaaggagccgagaggaggcggccctcgtgccgaat
tgcctgc
page-top