Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16053  (registered. 2007)
Contig Information
Length 786 bp
Clones 47 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 15
Wh_e Seed DPA10 6
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 4
Wh_r Root 4
Wh_yd Spikelet at late flowering 6
Wh_yf Spikelet at early flowering 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Solanum tuberosum] >gi|77745497|gb|ABB02647.1| unknown [Solanum tuberosum]
Score 667
Evalue 4.22308e-68
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16053
aatTCGGCACGaGGGTCGCCTTCCTGCTTGCCGCTCTCGCTCCGCAG*ACGCC*GCCGCCGCCGCCGCCGCCACGGCCA*G*AGCTCGACTCGCTCCCTA
G*AGGTAAGGATGGTGAGAGTCAGTGTGCTGAACGATGC*TCTCAAG*AGCATGTACAACGCTGAGAAGCGTGGGAAGAGGCAGGTCATGATCAGGCCTT
CTTCCAAGGTCATTATCAAGTTCCTTATCGTCATGCAGAAGCATGGATACATTGGCGAGTTTGAGTATGTTGATGATCACAGGTCTGGCAAGATCGTGGT
TGAATTGAATGGCAGGCTGAACAAGTGTGGTGTCATCAGTCCTCGCTTTGATGTTGGTGTCAAGGAGATTGAGGGATGGACTGCAAGGCTCCTTCCTTCT
CGTCAGTTTGGTTACATCGTGCTGACAACCTCTGCTGGGATCATGGACCATGAGGAGGCAAGGCGTAAGAATGTTGGTGGCAAGGTGCTAGGCTTTTTCT
ACTGAAAATGGAAAATGGAAAATTCGATGAAAGTATCCTGAGATGTGTTAGTAGGATATTTCCCAAGGAACACCTAAGTTGTCTTTTTTTGTCTGACTAG
CTGCCGCTG*C*TTGTTGAGTTATT*CTGGAAT*CC*GTTATGCACTTTCGGATTGGGTGCCTTTGTTTGAAAACTATGAGCTGTGCCT*GTCGTTAATT
CTGAAAAATCCATATGCAATATTATGTTGTTCCGTCGag*atAGATGTTAAGaggtttaaatctagtattctgcccggctcactga
page-top