Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16045  (registered. 2007)
Contig Information
Length 1037 bp
Clones 46 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 15
Wh_e Seed DPA10 30
Wh_h Spike at heading date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit low molecular weight glutenin subunit [Triticum aestivum]
Score 370
Evalue 1.87676e-33
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16045
acacatggATAATTAATTAAGGCACCAGGTTGCCCTtgtgact*ggaAAGACAAACTTATGAACTTGCAAGCATGGCAATCAGATCGACATCCACACAAT
GCCAATATGAACATTGTCTTGATACAACTTTATTTTTATTTTATTTCAGAATTTAAACAACTAGTATGGG*CGGGTCACACAC*GA*CATTGTGTGACAC
TTTATTTGTCACCGCTGCATCGACATATCCATCGACTAAACAACGG*TGATCCAACTATATATTACTAGAGACCTTTCCTTATTAGTA*GGAACCAACTC
CGG*TGCCAACACCGAATGGCACACTAGTGGTGGTTCTATACAACGGCACATTGACACGGCACATCGTTGGCAGGG*TACGGAGCGCAATGGAAGTCATC
ACCTCAAGCTGAGCTATCTGGTGTGGCTGCAAAAAGGTACCTTGTGCCAATTGTTGTTGTTGAGGTTGTTGCCCGAGTTGTTGTTGTGACTGCTGTTGGG
GTTGGGAAACACATTGGCCCAACTGTTGGGGTTGCTGCTGAGGAGTTTGGATGGAACCCTGAACCTGTTGTTGTTC*TTGCAGGATGATGGAGTAGATGA
TAGCACGGATTGCCTCATAGCGGGATTGCTGGGGGATTTGCGGCAACTGCTGGCAACATTGTTGTTGCATCACATGGCAACTGCTCTGCTGCAACATTTG
CGACCTAGCAAGACTTTGTGGCATTGCCACAGG*GC*TGCATTGCTGCTGGAGGAATACCTTG*CATGGGTTTAGCTGCTGCAAG*ATAGATGGATGAAC
AAATGGTATTTGTTGTTGCGGTAGAACTAGTTGTTGTTGTTGCTGCGAAAATGGTGGTTGTTGCGGTAGACTTGGTTGTTGTTGTTGCAAAAATGGTGG*
TTGTTGCTGTAGTACTATTTGTTGTTGTTGCGAAAACGGTGATTGTTGCTGTGAAAATGGTGGTAGTTGTTGCTGTGAAAATGATGGTTGTTGCGGTAGA
ACTGGTTGTTGTTGCTGCGAAAATGGTGGTTGTTgtt
page-top