Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16034  (registered. 2007)
Contig Information
Length 898 bp
Clones 45 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 14
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 5
Wh_r Root 4
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100192774 [Zea mays] >gi|195617050|gb|ACG30355.1| 40S ribosomal protein S9 [Zea mays]
Score 889
Evalue 9.87242e-94
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16034
acAAAAAACgangncaGCCTCAagngtTCACTTCTGCTCGGTGGTCACTAACCAAGCAAAACCGACACACATAAGTTTAATTTTAGAACCGACAGCCAAA
AGATTCTGAACCAACGAAAGCTCTACACCACTAAGTTTCTAAGAAGGAAAGTTTGAATCATTTCCGAGTTCCACAAGGCAATCTCAACATTTCTGCAACG
AAAGTTATGCGGGTGAGGCTGGGCGCTTAGTCTTCCTCCTCCTCGCCGTCATCACCACCACCACCTGAGGCCTTCTTCTGGTTCTTCCGCTTCACTCTTC
CAGGTTGGCCACCACCCAGGGGGCTGGTGAGAGAGAAGTCGACGTGCTTCTCAGTGTCCACCCTCACCATGAAAGAAGGAATGTTGACAAGCTGCTTTCC
AACCC*TGATGTGGCGCTGTCTGATAAGGACACGAGCATGATGGATTGACTTGGCCATGCCATTCTTGAAGACGATGGTCTGGAGACGGCGCTGGAGGAA
GTTGTCAACA*GTGAGGGCAAGCACATAATCAAGCTTGTTCTGTTCCTCAGTGAGAAGACCGTAGCGGTTCATGCGGCGGAGGAGCGCTGCACCCTCAAA
GATACGGCGGGGGTTCTTCTCATCCAGGGTGAGCAGCTCCCTGGCAGCATTTCGGATGCGGCTGAGGG*CGTACTGCACACGGTAGAGCTCACGCTTGGC
CCGCAGACCGTACTCCCCAACCAGCTTCAGCTCAGCGTCAAGACGCTCCTTCTCATACGGACGCCTTGGCTTCTTGAAGGTCTTCCCATAGTTGCGGTAG
AAGTTGACGTGCACCATGGCTGCCGCCTCCTCAGGATCGCT*CGGGTCGT*CGAGCTGTGCGCCGCCGGTGCTGGGGTGAGCCTCGTGCCGAATTCct
page-top