Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16030  (registered. 2007)
Contig Information
Length 1820 bp
Clones 44 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 41
Wh_oh Pistil at heading date 1
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Glucose-1-phosphate adenylyltransferase small subunit, chloroplastic/amyloplastic; AltName: Full=Alpha-D-glucose-1-phosphate adenyl transferase; AltName: Full=ADP-glucose pyrophosphorylase; AltName: Full=AGPase B; AltName: Full=ADP-glucose synthase; Flags: Precursor >gi|21687|emb|CAA46879.1| ADP-glucose pyrophosphorylase; glucose-1-phosphate adenylyltransferase [Triticum aestivum]
Score 2450
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16030
attcggcacgaggcacacatcactcaatatctatatccttccattgcttaTCCCTCGGCAATGGATGTGCCTTTGGCATCTAAAACCTTCCCCTCGCCCT
CCCCTTCCAAG*CGTGAACAATGCAACATTGATGGCCATAAGAGCTCATCGAAGCATGCAGATCTCAATCCACATGTTGATGATAGTGTTCTCGGAATTA
TT*CTTGGAGGTGGTGCAGGGACTA*GATTGTATCCCCTGACGAAGAAGCGTGCGAAGCCTGCAGTGCCATTGGGTGCCAACTACAGGCTTATTGATATT
CCTGTCAGTAATTGTCTGAACAGCAACATATCAAAGATCTATGTGCTCACGCAGTTCAACTCAGCATCTCTTAATCGTCATCTCTCACGAGCCTATGGGA
GCAACATTGGAGGTTACAAGAATGAAGGATTTGTTGAAGTCCTTGCTGCACAGCAGAGCCCAGATAACCCTGACTGGTTTCAGGGTACTGCAGATGCTGT
AAGGCAGTACTTGTGGCTATTCGAGGAGCATAATGTTATGGAATATCTAATTCTTGCCGGAGATCACCTGTACCGAATGGACTATGAAAAGTTTATTCAG
GCACACAGAGAAACAGATGCTGATATTACTGTTGCTGCCTTGCCCATGGATGAGG*AACGTGCAACTGCATTTGGCCTTATGAAAATCGATGAAGAAGGG
AGGATAATTGAATTCGCAGAGAAACCAAAAGGAGAACAGTTGAAAGCTATGATGGTTGATACGACCATACTTGGCCTTGACGATGCGAGGGCAAAGGAAA
TGCCTTATATTGCTAGCATGGGTATCTATGTTATTAGCAAACATGTGATGCTTCAGCTTCTCCGTGAGCAATTTCCTGGAGCTAATGACTTTGGAAGTGA
GGTTATTCCTGGTGCAACTAGCACTGGCATGAGGGTACAAGCATACCTATACGATGGTTAC*TGGGAAGATATTGGTACAATCGAGGCATTCTATAATGC
AAATTTGGGAATTACCAAAAAGCCAATACCCGATTTCAGTTTCTATGACCGTTCTGCTCCCATTTACACACAACC*TCGACACTTGCC*TCCTTCAAAGG
TTCTTGATGCTGATGTGACAGACAGTGTTATTGGTGAAGGATGTGTTATTAAAAA*CTGCAA*GATACACCATTCAGTAGTTGGACTCC*GG*TCCTGCA
TATCTGAAGGGGCAATAATAGAGGACACATT*GCTAATGGGTGCGGACTACTATGAGACTGAAGCTGATAAGAAACTCCTTGCTGAAAAAGGTGGCATTC
CCATTGGTATTGGAAAGAATTCACACATCAAAAGAGCAATAATTGACAAGAATGCTCGTATTGGAGATAACGTGATGATAATCAATGTTGACAATGTTCA
AGAAGCGGCAAGGGAGACAGATGGATATTTCATCAAAAGTGGCATTGTAACTGTGATCAAGGATGCTTTACTCCCTAGTGGAACAGTCATATGAAGCAGG
TGTGAAATGTGTGCCAAGGGACAGGGCTACTTGCATCAGTCTGGAATCAACCAACGAGGCCGCGAAGAGATCATAAGAGCAATAAAAAAGGAGTGCCATG
CAAGGCACTTCTCCACCCTTTTTCTCCCTTGATGTATTAGGAACTGTGATGTACAAGCAACTGTGATGCACTTAGGCGAAGTGCCCCTGGATCCAACTTT
CTCTTTGCTTGTAGTTGATTT*CCAGCAGACCATGCTATTTGTTGTATG*GTTCATGTAAAACCTTGCGTTGCTTTATCTATATCTATATCTATACCAAT
Ataaaaagacccaaaggggt
page-top