Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15980  (registered. 2007)
Contig Information
Length 615 bp
Clones 41 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 20
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 4
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=40S ribosomal protein S29 >gi|57471722|gb|AAW50992.1| ribosomal protein S29 [Triticum aestivum]
Score 318
Evalue 7.39628e-28
Total Hit Count 332
Registered year 2007
Contig Sequence     [ Download ]
>Contig15980
ctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctctct
ctctctAAAGGTAGGGTTTCCAGTTGCAAGCCGCGCCGCCGCCGCCGCCGCCATGGG*ACACTCGAACGTC*TGGAACTCGCACCCCAAG*AACTACGGC
GCCGGATCCAGGGTTTGCCGTGTCTGCGGCAACTCGCATGGCCTGATCCGCAAGTACGGGCTGATGTGCTGCAGGCAGTGCTTCCGCAGCAACGCCAAGG
ACATTGGCTTCATCAAGTACCGTTAAGAATGGAAACCTCAAAGGAAGCAAGGACTAGGAAATTATCAACGAAC*TGTGGTGCTTCATCGAGGCTGATCTT
TATCCTATAAGCTATGTAATGAACTACTATTATGTTTGAATCCTGGTGACAAAACCGTGAAACCATGTTAGCGAC*TGC*TGTTTGAGCATGTGAAACCG
*ATAATT*CTGTTACTGCGTGCCATTATGGTTAGAAGGTTGCT*CTGCATCCTTATATTTTTATTat*ctTGCGAAGGCcggccatgcatttgttttgat
gctctaaaaaaaaaa
page-top