Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15969  (registered. 2007)
Contig Information
Length 971 bp
Clones 40 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 18
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 4
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 5
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100192774 [Zea mays] >gi|195617050|gb|ACG30355.1| 40S ribosomal protein S9 [Zea mays]
Score 889
Evalue 1.10913e-93
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15969
ttttttttttagagtaaaataactcagaaccagggcTGTCAAACCGATAACAAG*A*TACGTTTGGTTCACAAAAAACGAAGCAGCCTCACTGAGTTCAC
TTCTTATGCTCGGTGGTCACTAACCAAGCAAAACTGACAACCATAAGTTTAATTTTAGAATCGATAGCTGAAGCAACGAAAGCTCTACACCACTAAGTTT
CTAAGAACGAACCAAAGTTTGAATCATTTCACGTTGCAAGTTCCACAAGGCAATCTCAACATTTCTGCAACGGAAGTTATGCGGGTCGAGGCTGAGCGCT
TAGTCTTCCTCCTCCTCGCCGTCGTCACCACCACCACCTGAGGCCTTCTTCTGGTTCTTCCGCTTCACTCTTCC*AGGTTGGCCACCACCC*AGGGGGCT
GGTGAGCGAGAAGTCGACGTGTTTCTCAGTGTCCACCCTCACCATGAAAGAAGGAATGTTGACGAGCTGCTTTCCAACCCTGATGTGGCGCTGTCTG*AT
GAGGACACGA*GCATGATGGATTGACTTGGCCATGC*CATTCTTGAAGACGATGGTCTGGAGACGGCGCTGGAGGAAGTTGTCAACAGTGAGGGCAAGCA
CGTAATCAAGCTTGTTCTGTTCCTCAGTGAGAAGACCGTA*GCGGTTCATGCGGCGCAGGAGCGCTGCACCCTCAAAGATACGGCGGGGG*TTCTTCTCA
TCCAGGGTGAGCAGCTCCCTGGCAGCATTTCGGATGCGGCTGAGGGCGTACTGCACACGATAGAGCTCACGCTTGGCCCGCAGACCGTACTCCCCAACCA
GCTTCAGCTCAGCGTCAAGACGCTCCTTCTCATACGGACGCCTTGGCTT*CTTGAAGGTCTTCCCATAGTTGCGGTAGAAGTTGACGTGCACCATGACTG
CCGCCT*CCGCAGGATCGCGCGgcgTCGT*CGAGCTGTGCGCCGCCGGTGGGGGTGAgcctcgtgccgaat
page-top