Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15967  (registered. 2007)
Contig Information
Length 883 bp
Clones 40 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 13
Wh_e Seed DPA10 4
Wh_h Spike at heading date 4
Wh_r Root 6
Wh_yd Spikelet at late flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0962600 [Oryza sativa (japonica cultivar-group)] >gi|15289927|dbj|BAB63622.1| putative 40S ribosomal protein S10 [Oryza sativa Japonica Group] >gi|113535011|dbj|BAF07394.1| Os01g0962600 [Oryza sativa (japonica cultivar-group)] >gi|125529217|gb|EAY77331.1| hypothetical protein OsI_05313 [Oryza sativa Indica Group] >gi|125573409|gb|EAZ14924.1| hypothetical protein OsJ_004749 [Oryza sativa (japonica cultivar-group)]
Score 498
Evalue 2.03609e-48
Total Hit Count 330
Registered year 2007
Contig Sequence     [ Download ]
>Contig15967
ttttttttttaaatagcaAGTTGACC*TCTTTAGATTCTCAGTCGACCAACATCTGTCTTAATATCAAAG*AGCTCATTCTAACACAAACGAACCCATAA
ACCATGGT*CTTAAGCTACAATCTCGATAAACAAAATCATCGCAGTGTTTGCAGAATTCAAACATCAACAGAGAGGACAGCACCCCACGCGCGCATTGGA
TCTGAAGACCTGTTGGGTGCTCCCACTTGCTGAAGAGTCGCTTCTTCACTCCATGGTAGCTCCAGAACCAAAAGTGCCGCCGCCGCCTCCACGGCCAAAG
GGCCTGGCAGCACCACCAGCACCCCTGAAAGCTGGCTGGTACTCAGCAGGAGCTCCACCCTTCTCACCAGCAAAATCCCCTGGAGCACCACGTGGGCCTC
CTCTGTAACCATCCCTGTCACCATACCTGGGCCTGTCACCCTCAAAACGAGGAGGACCCCTGGGGCGGTCACCCGGTGGGCCAGAGCCGAAGGGGCGGGA
CGGGGGCTTGGCGGACTTCTTGAGGGTGTTGGGCACAATCTCAGACGGCAGGTTGAGGAAGGTGCGTAGGAACTCAATGCC*GTCGTTGGTCAGGTACCA
GTAGTAGTGCTGCCACGAGAAGGTCTCCC*T*GACGTACT*CCTTGGACTTGAAGCTCTGCATGAGCTTGATGACCT*CCAGGTTCGAGGCATCGACCT*
**GGGGGTGCTTGGCCAGG*TT*GTAGTCCTTCTTGGCGTACAAGACTCCCT*CCTGGAAGAGGTACTTGCAGAT*CTCGCGGCGGTTCTTCTTGGAGAT
GATCATGGTGACGGGCGGCGGCGGGGacggagacggcgtgcaggggagcgggaggcggagcgcggctgctgcctcgtgccgaa
page-top