Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15960  (registered. 2007)
Contig Information
Length 918 bp
Clones 39 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_SL Seed DPA30 10
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 3
Wh_r Root 1
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein CAGL0M03135g [Candida glabrata CBS138] >gi|49528797|emb|CAG62459.1| unnamed protein product [Candida glabrata]
Score 81
Evalue 4.92804
Total Hit Count 7
Registered year 2007
Contig Sequence     [ Download ]
>Contig15960
ttttttttttgAACAAAAGATGGGTCACGCGACCCAG*AAACTGCATTAAC*CATAG*ATCGGTAGCACTAGCACACCGTAGTTTACAACAGGACACACA
AAGGAAAGAAAATTACAGACCAGTCCCTGTTTTTTGCATGGAGGACCCCGAACAGGAAACAA*G*AAATGCAAT*CGGGTCCAAATCATCTCCCAACCGG
*ATCCAATCCCGTCGTCGCCGGGGACGTTAGCACTTGGTACGTCGGGACCTCCGCAGCTGCTTCTCCCATAGCACAACACCGCAGAAGAAGAAGCCTTAG
ACTCCGATTCGGAGATGAACTGCCTCCCATCTAGGCACCAGGCCGGGAGGAAGAGAAAGGGCCGCCCTTCGGCCAGCATATTCAATGGCGAGACGGTGAG
GACCGGCTGCCGACAGCCGAAGCGGGCGCCGTTGCCTCGTCTCAAACCCATTGAGGATGAGCTCCTTCCCAAACTGCAAAGT*CCAG*CTCGCCGCCTCT
*CCTTCTTCCT*CCATCCACCA*CCACGATGGCTTGAAAAGAAAGGGTAGAGCAGCC*GGGCCTCCACCTTAACAGGAAACACAACGAGCTTATTGAAGG
AGTCGCC*GCCGTCATTTCCT*CCGGTTGCACGCAGCACCTCGCCACCGCAACCATCAGAAACGCCGACGCTAGCCACCAGGCGCAGCT*CGCGTGCGCC
GGCGGCGCGCTCCACCACGGCATAGCGCCAGACACCACTTGGGCAAGACTCGATCTAATCCTAGACCTGCTATTTACAGATCTCCACACACCTCTCCCAT
CTCTCGTCCGGCCGGCATCGCCGTCGTCGGAGATTGGGGATCGGGCGGGATCGGGGAAGCTACAGGCGACTC*TCAAGGGGCTCT*CTAGAAGGGACTCG
CTCCTGCTTtgGTTCGgc
page-top