Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15946  (registered. 2007)
Contig Information
Length 980 bp
Clones 38 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_dL Crown of seedling 7
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 6
Wh_r Root 6
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-beta; Short=EF-1-beta; AltName: Full=Elongation factor 1B-alpha 2; AltName: Full=eEF-1B alpha 2; AltName: Full=Elongation factor 1-beta'; Short=EF-1-beta' >gi|218341|dbj|BAA02436.1| elongation factor 1 beta' [Triticum aestivum]
Score 782
Evalue 2.92603e-81
Total Hit Count 474
Registered year 2007
Contig Sequence     [ Download ]
>Contig15946
gaggaattcggcacgaggggactttag*cctcctgcgcCGCCGCCGCCGCCGCCCAGCGAATTCGACAAGCCCCCGAGCTCGCCGGATCCGATGGCCGTC
ACGTTCTCCGACCTCCACACCGCCGACGGGCTCAAGGCCCTCGAGGCGCACCTCGCCGGCAAGACCTACATCTCCGGCGATGGGATCACCAAGGACGACG
TCAAGGTGTT*CGCGGCGGTGCCCGTGAAGCCCAGCGCCGAGTTCCCGAACGCTGCCCGCTGGTACGACACCGTCGCCGCGGCTGTTGCTTCAAGGTTCC
CTGGCCAGTCCTCTGGGGTGAGTGCATCATCGGCTCCTGCTGCAGCTGCTCCTGCCGCTTCCAAGGATGAAGATGACGATGATGACATGGATCTGTTTGG
CGATGAGACCGAGGAGGACAAGAAAGCTGCAGCTGAGCGTGAGGCTGCCAAGCCTGCAAAGAAGAAAGAAAGTGGCAAATCCTCCGTCCTCATGGACATC
AAGCCATGGGACGATGAGACTGACATGAAGAAGTTGGAGGAGGCTGTCC*GCAGTGTTCAAATGGAGGGTCTCACCTGGGGTGCATCTAAGCTTATGCCT
GTGGGTTATGGCATCAAGAAGCTCCAGATCATGCTGACGATCATCGATGACCTTGTGTCCGTCGACACTCTTATTG*AGGAAGTGCTTTGCGAGGCGCCC
ATCAACGAATATGTCCAGTCGTGTGACATCGTTGCCTTCAACAAGATCTAGAATCTTTGTTCTCCCACCTGCTGGATTCTTGGTACTGGGATTGGTCGAT
CTGGAAAACATTATGTCGTCCCATTTAGTTACCCCTCTTACAGAAATGCTACTGGTTTTGTTTTTGAGTGATGCCCTGGTCTTGAATGTCTGCTACCTTT
AAATAGTTGAACTGCTGAGCGGTTTGTAATGGCGAAACATCTATCATGTGGAGTAAAATCAGTCTTTGAtaaaaaaaaaa
page-top