Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15944  (registered. 2007)
Contig Information
Length 757 bp
Clones 38 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 8
Wh_dL Crown of seedling 6
Wh_e Seed DPA10 2
Wh_h Spike at heading date 8
Wh_r Root 6
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0342200 [Oryza sativa (japonica cultivar-group)] >gi|31043871|emb|CAD91551.1| eukaryotic translation initiation factor 1A [Oryza sativa (japonica cultivar-group)] >gi|54290949|dbj|BAD61630.1| putative eukaryotic translation initiation factor 1A [Oryza sativa Japonica Group] >gi|113595611|dbj|BAF19485.1| Os06g0342200 [Oryza sativa (japonica cultivar-group)] >gi|125555219|gb|EAZ00825.1| hypothetical protein OsI_22855 [Oryza sativa Indica Group] >gi|125597122|gb|EAZ36902.1| hypothetical protein OsJ_020385 [Oryza sativa (japonica cultivar-group)] >gi|215708861|dbj|BAG94130.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767517|dbj|BAG99745.1| unnamed protein product [Oryza sativa Japonica Group]
Score 568
Evalue 1.17805e-56
Total Hit Count 321
Registered year 2007
Contig Sequence     [ Download ]
>Contig15944
cgagGaCCACCACCGCTCCCCATCTCGATCTAAAGCCGAGGGTTTCGTCCAGCTC*CGTCGCCGCGACCCAA*GCCAGAGCCAGCCCCACCCCA*GCCAG
CCAGCCATGCCGAAGAACAAGGGTAAGGGAGGCAAGAACCGCAA*GAGGGGCAAG*AACGAGGCCGACGACGACAAGCGCGAGCTGGTGTTCAAGG*AGG
ACGGGCA*GGAGTACGCGCA*GGTGACGCGGA*TGCTCGGCAACGGGCGCTGCGAGGCCATCTGCGTCGACGGCACCAAGCGCCTCTGCCACATCCGGGG
CAAGATGCACAAGAAGGTCTGGATCGCCGCCGGGGACATCGTCCTCGTCGGCCTCCGCGACTACCAGGACGACAAGGCCGACGTCATCCTCAAGTACATG
AACGACGAGGCCCGCCTGCTCAAGGCCTACGGGGAGCTCCCCGACACGCTCCGCCTCAACGAGGGCGTCGACGTCGACGGCCCCGAGGAGGGCGAGGGCG
ACAGCGACTACATCCAGTTCGAGGACGAGGACATCGACAAGATCTAAGCTTTTTTCCCCTCCTCCTCCCTCGCTCGATATACTTTGTGTTCTATTCTGTT
CTAATAGCGTCCGTGTCTGTCTGTGTCG*GTCG*GTCG*GTGGGC*T*GTTGTGGATTGATGGATTTGGTAACGAGAAATCGTTGTGATTTGAGGTGCTT
AAATAATTGTCGG*ATTATAGTGTTCGTCGTATTATTATGCTT*GCAACAAGCCAtc
page-top