Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15938  (registered. 2007)
Contig Information
Length 1170 bp
Clones 38 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 8
Wh_dL Crown of seedling 10
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 6
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 643
Evalue 5.02341e-65
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15938
gaggaattcggcacgaggCTCTTCCGTCGCCGTCGATTCGAACCTCCCCCAAATCAGCAGCAGTCGACCGGAGGCGCCGCCATGGC*CCGTACCAAGCAG
ACCG*CCCGCAAGTCCACCGGCGGCAAGGCGCCCCGCAAGCAGCTCGCCACCAAGGCGGC*GAGGAAGTCGGCGCCGACCACCGGCGGAGTGAAGAAACC
CCACCGCTACAGGCCGGGGACCGTGGC*GCTCCGGGAGATCCGCAAGTACCAGAAGAGCACGGAGCTGCTGATCCGCAAGCTGCCTTTCCAGCGCCTGGT
CCGCGAGATCGCGCAGGACTTCAAGACGGACCTCCGCTTCCAGTCCCACGCCGTGCTGGCCCTCCAGGAGGCGGCCGAGGCGTACCTCGTCGGGCTGTTC
GAGGACACCAACCTGTGCGCCATCCACGCCAAGCGCGTCACCATCATGCCCAAGGACATCCAGCTCGCCCtcagaaccatgttgttccttttggtttgcg
ATGTGATGTTCCTTTTGGTTTGCGATGAAGCAAACGTATGTCTATGTTGAAGACCTCAGAACCATTGTTGTTCGCTGCAACTCTGTTGTTGTCGTGCCCT
TGATCCCATCGTGGTATTGTATCAAAAAAACCAATGGAGCAACGACACCGTGAAAGAAGACAACGTTTGCTCAAGTCACAGGCTGATACAGCATTCAAGC
TGAAGGAGTATAAGATGGCATCAGAGTGTTATGGTCTGGCAATAGATCATGGAGAGAGTGCAACACTGTATGCAAACAGGAGTGTTTGTAAACTGCTCAT
GGGTGATGGTGAAGGTGCTTTGTCAGATGCTCTCAGGTGCAGAATGCTGCGGCCTGATTGGGCAAAAGCTTGCTACCGTCAAGCTGCAGCTCATATGCTA
CTCAAGGAGTATAAGCAAGCCTGTGATGCTCTCTTGGATGCACAAAACTTGGATCCTGGGAATGCTGAGATTGAACATGAACtacggaaggctagggaac
tcatgaagaatcctcctgccgaaggtgagcagtgaggcgcgggcgtgcgcaggctggaacatgttccacctttcagtaaagtagagctatagcaggaact
tnctgatnccttgtgttgtgcnacgaaattncatgcgaaaaaacncgtgnanngcggnagtgntaaaaca
page-top