Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15932  (registered. 2007)
Contig Information
Length 724 bp
Clones 37 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 12
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 7
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100194345 [Zea mays] >gi|194695580|gb|ACF81874.1| unknown [Zea mays]
Score 583
Evalue 1.9789e-58
Total Hit Count 338
Registered year 2007
Contig Sequence     [ Download ]
>Contig15932
ttttttttcaacAGTAATATATCGAATCACTTCAGATAAACGGTGAGATAAACAGATCATGTCCACCATACGCAG*ATCAAAACACCTCGAACTTAAG*C
CTTGAGTTCAAAACATTACTTGCCACAA*GTAACAG*ATCTAAAAG*ACATAAAGCATAATATAGGGGTACGATGACGATGCGGAGGAACCTAGGCGCGG
TTGCCACCGCGGGGTCCGTTGAAGGGCTGGCGGTAGGGGGCGGCGGCAGAGGTGGTTTCGGGGGCGCGCTCGACGCCGGGGAGGTCAGCCATGCCGAGGA
ACGCCA*GCATGTCCATGGTCTCCTTGTCGACGCGGATCTCGTCGACCTCGAGCGCCGACTTCTCCGGCACGAAGTCCATGCGGCGCTCACGCTCCTCCT
CCTGCAGCTTGAGGGAGATGCCGC*GCACGGGGCCGCGCTGGATGCGGCGCATCAGATGGGTGGTGAAGCCGGCCACCTTGTTGCGGAGGCGCTTCGACT
GGAGGATGGAGACCTCCTCTAGCACCTTCTTGTTGGTGT*GG*AAGTCGAGGGTCATCC*GAGAGTAGTACTTCTCGATGACCTGGCGGGAGGTCTTCTT
CACGGTCTTGGTGCGGACGCGACCCATGGCTGCGGCTGCTCCCTCTCCTTCT*CCGGCGGCGGCGGCGGCGACGGCGCTGGTTGGTGGTGCGGCGGCGCg
agggcggcctcgtccgaattcctc
page-top