Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15924  (registered. 2007)
Contig Information
Length 555 bp
Clones 37 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 37
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Gamma-2-purothionin >gi|100844|pir||S11530 purothionin gamma - poulard wheat >gi|227203|prf||1616227B purothionin gamma2
Score 266
Evalue 6.13227e-22
Total Hit Count 185
Registered year 2007
Contig Sequence     [ Download ]
>Contig15924
ttttttttttgAACATGAACCGTACGTTTTTATTCATTCATATTATTAT*CTTGCATGCATCGAT*CGAG*ATGCAGCAGCTGGCTAGTGGCGACACGG*
ATATACATACGACATACGTACGTATAAGGGGGCACACACACACACACACACATTCAAGTAGGTACACAGACGTATGGCTCCATGGGCTAGCTAGCTGACG
TACGGCGAGGGCCAGCTAGCCGTAGCATTCCACATATGATCA*GCACTGCCTGATGCACTTGCACCGGCGGAGGGGCCCGTCGCAGTTGCCGCCGCCCCA
GCGTTCCTGCAGGCA*GACCTGCGCGCAGTTCTTGTCCGACACGCATGGCCCCTTGAACCCCGCGCT*GCGCTGCCGGCAGATCTTCGCCTCCGCCCCCG
GCACCGCCGCCTCC*TGTGCGATGAGGAGGAGAAGCAGGACCAAAACCACCTGCGTCGCCACCTTCTTGGTCCACATGGTGAGCGGCCGGGCTGGGAGCG
AGCTAAACTCTGCTTGCGCTACGTACTGGCTTTGTTACTACCGGTGGAGTTGTgc
page-top