Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9476  (registered. 2012)
Contig Information
Length 957 bp
Clones alternative view 42 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XA Root 7
WH_XC Root, treated at 50 microM Al for 6h 8
WH_XF Seedling, infected with leaf rust 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242040427|ref|XP_002467608.1|| hypothetical protein SORBIDRAFT_01g030880 [Sorghum bicolor]
Score 346
Evalue 3.00E-93
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9476
TTTTTTTTTTGAAATGTAAATGTGCCTTGAAAAACAGAGGAGGAGCTGTCACAACGACCACACAAGTTTTCAAACTGATAATACCGCATGCTTGCATGTG
ATGTGTTCCTGAGAAACGTCGCCATTATTATTCGAGAAAAAGAAACAGAAACGTGGCCATTTTAGTAATTCCAGCTAATTCCACACTTGGCCATTTTCTC
CTTGCATGCACCACCCACCCACCATGTCACCATGCCGCTTTATTGGGTGCTTGCAGCAGCCGCGGCGGAAAGCCGGGCCTGTATTGCCCCGGCGTACTCA
ACCACCCTGTCGACGTCCTGGAAGACCGCCTTGGCGGCGTCGAGCTCGCTAATGCGCTCCATCCATGCCGCCAGCAGCGGGGCCTTGCCGGCGTCTATTA
ACTTGTCGCCGGAGAGCCTCTCGGTGGCGCGCACCCACGGCACCATGCTGCCGAGCAGGACGTCAACGTACCCGACGCAGTCGCCGCCGAAGAAGCCCTT
CCCCTTGGAGCACTCCCTGAGGCCATCCTCCAGAGGACCCAGCGCCGCCGCCGTCTGCCTCGTCCACTCGGCCCTCTCCTCGTCGGTCTTCACCCTGAAC
ACCTTCCCCCACGGCGCCAGCAGCTTGTCCTCGACGTAGGCGGCCCAGAATCGCGCGACGGCGCGCTCGTAGGGGTCAGCGGGGAGGAGGGGCGGGCCGA
CGCCGGCGAAGGCCTCGTCGATGTACTGGAGGATGACCTGGGACTCGCAGACGGGCTTGCCGTTGTGGATGAGGATCGGGACTGTCTTGTGCACCGGGTT
GGAGCGGAGGAAGAGCTCGCTCTTGCTGGCGAGGTCCTCCTCGACGTACTCGTAGCTCACGCCCTTGAGGTGGAGCGCGAGCTGCACCCTGACCACGTAT
GGGCTCGCCCACATGCCCAGCAGCTTCAGCTCGTCTCCTCCGTTGGCCATTTTCTGC
page-top