Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15897  (registered. 2007)
Contig Information
Length 716 bp
Clones 36 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 8
Wh_dL Crown of seedling 7
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 6
Wh_yd Spikelet at late flowering 11
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit histone H4 [Zea mays]
Score 410
Evalue 2.18884e-38
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15897
cgcagccgcaccccaccatgactggagctgctcttctccggcaccgccgtctgtgtgcacgtatggtggtggaggggagtaggaggccatggcgaggagc
gaggaggagggaggggccgtgggaatgggccatggcgaggagcgagaaggagggaggggctgtggggatcgatAGAAGCCAATCTCGCCGG*AGAAAG*A
AGCGTCGACGATGTCCGGCCGCGGCAAGGG*AGGGAAGGGGCTGGGCAAGGGCGGCGCCAAGCGCCACCGG*AAGGTGCTGCGCGACAACAT*CCAGGGC
ATCACCAAGCCGGCCATCCGTCGTCTGGCTCGGCGTGGCGGCGTGAAGCGCATCTCGGGGCTCATCTACGAGGAGACCCGCGGCGTGCTCAAGATCTTCC
TGGAGAACGTCAT*CCGCGACGCCGTCACCTACACCGAGCACGCCCGCCGCAAG*ACCGTCACCGCCATGG*ACGTCGTCTACGCCCTCAAGCGCCAGGG
ACGCACCCTCTACGGATTCGGCGGCTAGGCC*GCGCCGGTCCAGCAGAACCCACCTCCCGCCGCCAGATTCACTAGCTAGCCATCGGTCGT*CCGTGTT*
CATGGTCTTTGTTGTAATGGAACG*GCCGCAT*CTCGCTGCTGT*CTGTTGTTT*CG*ATGTAGTACTACTAGCATGGAATGGAAATCTCAGCGTTTTTA
CCCCTgaaaaaaaaaa
page-top