Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15889  (registered. 2007)
Contig Information
Length 955 bp
Clones 35 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 7
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 10
Wh_f Spike at flowering date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195605604|gb|ACG24632.1| 40S ribosomal protein S24 [Zea mays] >gi|195657831|gb|ACG48383.1| 40S ribosomal protein S24 [Zea mays] (no hit)
Score 571
Evalue 6.04128e-57
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>Contig15889
accccaacaccaaaccatccaacgaacaaaaaccaagttcatttgcatcggccagtTGGAGTTGCCCTTACGTGAtcagcATTCGAGTTGCCCAAAGGGC
ACTCCTCGG*ACAACATACCTACAGTATGAAACGTAGGTACAGCGGCTACAGGCCTACGGCAACCCAGTACCACATGCTCAGTCTCGAAGTTACGAAACC
ATAACAGAAGCATATTCAGCACGCATTCACGATG*CACTGATAG*AACGTTAACTTAACATCCACCATAGTTACAAATCCATGTTACATAATTCACTTAT
AGCCCCATG*CTTCAG*AATT*CATT*CATAATCCAGAA*AATAGTTTATTCAGGATACTGTTCCAGATCATAGTTTTGATGCTT*CTGGTGTTTAC*TG
CATTCCCC*TGTCATCAGACCCTACCAGGAGGAATTCTTTATCCCTCCAGCCTCAGGTTCTTCTCCTTGGCACCTTGAGCCTTCTGCTATCTTTGGCTTC
TTGCATTCCACCTCATCTCCAATAGGAGTGTGTGGTCGTTTCGTGATATCGGGTTTCTTTTCATCATCTAAGAGCTTTCTATCCGACTCGTCCACATCCA
CGTCGTCGTCCTCGTCGCCTTCGTCGTCCTCGTCGCCATCCTCGCCCTCGACGATGTAGAATACATCACGAGCACGTTCGAAAGCACTCATTTCCTCTCG
TAACTTGTCGATCTTTTGCTCGAACGTCTTACCATCAGAACTGTTCATGATCGCGCGGATCTTGTCCAGACCAAAGTGTTGGAACAGGTCGGTCAGGCGA
GGAGGAAGAGGCGACGACTGTGGATAGGGTGAATAAATCACACTACAGTAGCC*TTTGTCGCCGGTTGTCTTGCCTTCGCAGCGTGATGCCATCCCAGCC
ATGGTTGCCGGAGGGGAACGGCGGCGGCGTGGGTAGATGGCTAGGGTTTCCctcg
page-top