Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15877  (registered. 2007)
Contig Information
Length 1097 bp
Clones 35 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 7
Wh_SL Seed DPA30 8
Wh_dL Crown of seedling 8
Wh_oh Pistil at heading date 4
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L9 [Zea mays] >gi|195624144|gb|ACG33902.1| 60S ribosomal protein L9 [Zea mays]
Score 861
Evalue 2.3932e-90
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15877
caatacaaactattctacatggacaaccatccagacacagtgctgcttaagagccacacaacaaaatgcagtaacaagcggcaacatttctaccttggca
gcaagaacttaagcagctcaaatagagaaggcaggcAATGTAAATGCATAAC*CAAATCATTTAACACTAG*AGCACACGCAGCGCATTCATGTCCTGTT
TTAACTTCAAATACCTGAAGTCATCAACCTTTAGGGGAAGATAAGCGTCGTACCAATTCTCACGGTGACAATATGTAGGATAATAAAGATAACATGTTGC
ATAGCGCATCCCTAATTAACTCCACTACAAAATTCAGTCTAGAGAAAGTTCAAAATCACAACCACGACACAAAGACGATGAAACACGGC*AGGCAGAAAC
ACGGCTTCTGGGACGGTTTTCGCACTCTACTCCTCCTTGATGGCGCCCTTGTCGCTGACGTAGATACCGTCCAAGAACTTCCTGATATCCTTGTTCTT*G
ACGTGGCATTTCTGGTTGATGAGGGCGGCGGAGCGGGAGACGAGCTCGATGTCATT*GCCGTCGAGGACGATCTCATCCTTGACCTT*CTCGGACCGCAA
GATGGTGACCCCGTCGAGCATGTCCACCTT*CCTCACCTTCTTCTCGCCGAGGAAGTTCCTGATCTCGATGCCCCGGTTGGCGGCGGTGATGGAGGCGTT
GATGGGG*AAGTGAGCATACACGAAGCGCAT*CTTGTAGCGGAAGCCCTTGGTGACCCCGGTGATGAGGTTCTGG*ACGTGGGAGATGGCGGTGCGGATG
GCGGCCATGGTCTTGCGGGTGCCGAACCAGGCGTCCACCTTGAGCTTGCGCCCGCCCTCCTGCAGCTGGAAGTCGAGGTTGAGGTGCTTGAAGTTGCGGG
TCAGCGTCCCCCGCGGCCCCGTCACCGAGATCATCTTCGCCGACACCTTCACGGTCACCTCCTCCGGGATCTCCATCGTCTCCGACGCCAGGATGGTCTT
CATCTTCGCCGGTGATGGGGGctgggctggggcgaggtggcggcggcggcggcggaggaggaggaggagggcaggggcgagcctcgtgccgaattcc
page-top