Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15866  (registered. 2007)
Contig Information
Length 582 bp
Clones 34 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 13
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 2
Wh_yd Spikelet at late flowering 8
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit histone H4 [Zea mays]
Score 412
Evalue 8.20259e-39
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15866
tttttttttttaacgcaatcgaccgattttatcatgaatcaacagaaccagactccaAAATTCAACGATAAACTGCTCCAATTTCAATTCCATTCGATCC
TACAGAAGATAGCGAA*CAACAG*CGAG*ATGCTGCGATTACAGCAACGACCACGAACCCTAGGCACTCTAATCTGGTGGTGGTGGCGGCCTAGCCCCCG
AAACCGTAGAGGGTGCGTCCCTGGCGCTTGAGGGCGTAGACGACGTCCATGGCGGTGACGGTCTTGCGGCGGGCGTGCTCGGTGTAGG*TGACGGCGTCG
CGGATGACGTTCTCGAGGAAGATCTTGAGCACGCCGCGGGTCTCCTCGTAGATGAGCCCCGAGATGCGCTTCACGCCGCCCCGACGCGCCAGCCTCCGGA
TCGCCGGCTTGGTGATGCCCTGGATGTTGTCGCGGAGGACCTTCCGGTGGCGCTTGGCGCCGCCCTTGCCGAGCCCCTTGCCTCCCTTGCCGCGCCCCGA
CATCTTCTCGCTTCTCTCTCTTCTTCT*CCTGGGTGAGGTTGACCTGT*C*TTT*CTTTGTGAGGTAGGTGGTGGCTGCGgc
page-top