Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15857  (registered. 2007)
Contig Information
Length 1934 bp
Clones 34 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 5
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 8
Wh_oh Pistil at heading date 4
Wh_r Root 5
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 2394
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15857
tgcaggcaatTCGGCACGAGgccTTCTCTGCATACACCAagnaAGTCGCCTCCCTTGCTTTCCTTCCTCCAGCAGTGCGCGCCCCTCCTCTCGAGATCTT
CCCCGAGTTCCTGAGATCTGGTTGTAAGCAGCCAAGATGGTGAAGATCTGCTGCATCGGAGCTGGCTACGTCGGCGGCCCAACCATGGCCGTCATTGCCA
TCAAGTGCCCGGCGATCGAGGTTGTTGTCGTCGACATCTCCAAGCCCCGCATTGACGCCTGGAACAGCGACACCCTCCCCATCTACGAGCCCGGCCTCGA
CGACGTTGTCAAGGCCTGCAGGGGCAAGAACCTCTTCTTCAGCACTGATGTTGAGAAGCATGTCGCCGAGGCCGACATCATCTTTGTGTCCGTGAACACC
CCCACCAAGACCCGCGGCCTGGGAGCCGGCAAGGCCGCCGACCTCACCTACTGGGAGAGCGCCGCCCGGATGATCGCCGACGTGTCCAAGTCGGACAAGA
TCGTCGTCGAGAAGTCCACCGTGCCTGTCAAGACCGCCGAGGCCATCGAGAAGATCCTGACCCACAACAGCAAGGGCATCAACTACCAGATCCTGTCCAA
CCCGGAGTTCCTCGCCGAGGGCACGGCGATCGAGGACCTGTTCAAGCCCGACAGGGTGCTCATCGGCGGCCGGGAGACCCCCGGGGGCCAGAAGGCCGTC
CAGGCCCTCAAGGAGGTGTACGCCCACTGGGTGCCCGAGGC*GAACATCATCACCACCAACCTGTGGTCGGCCGAGCTCTCCAAGCTGGCCGCCAACGCG
TTCCTGGCGCAGAGGATCTCGTCCGTGAACGCCATGTCGGCGCTGTGCGAGGCCACCGGCGCCAACGTGTCGGAGGTGTCGTACGCCATCGGCAAGGACT
CGCGGATCGGGCCCAAGTTCCTGAACGCCAGCGTGGGGTTCGGCGGGTCGTGCTTCCAGAAGGACATCCTGAACCTGGTGTACATCTGCGAGTGCAACGG
CCTGCCGGAGGTGGCCAACTACTGGAAGCAGGTGATCAAGATCAACGACTACCAGAAGAGCCGGTTCGTGAACCGGGTGGTGTCGTCCATGTTCAACACG
GTGTCCGGCAAGAAGATCGCGGTGCTCGGGTTCGCGTTCAAGAAGGACACGGGCGACACCCGGGAGACGCCGGCGATCGACGTGTGCAAGGGCCTGGTGG
GCGACAAGGCCCAGGTGAGCATCTACGACCCGCAGGTGACGGAGGAGCAGATCCAGCGGGACCTGGCCATGAACAAGTTCGACTGGGACCACCCGATGCA
CCTGCAGCCGACCAGCCCCACGGCGG*TGAAGCAGGTGAGCGTGGTGTGGGACGCGTACGAGGCCGCCAAGGGCGCCCACGGCGTGTGCATCCTCACCGA
GTGGGACGAGTTCAAGAAGCTCGACTACCAGAAGATCTTCGACAACATGCAGAAGCCGGCCTT*CGTGTTCGACGGCCGCAACGTGGTCGACGCCGAGAA
GCTCAGGGAGATCGGCTTCATCGTCTACTCCATCGGCAAGCCGCTCGACGGGTGGCTCAAGGACATGCCCGCCGTGGCCTAATTCCTCTCCCTCCCTCGT
CGGCCGGTCCGCCGGGCCGGAGCTGCAGGGGAAGGAAGCAAGGAAGGAAGAGCAAGAAGTGGTTTGACCGTGATTCATTCTTTATAGTTTGCATTTTGCA
GGAGAAGCATCCACATTTTCTCTCTCGGCCATAAGAATTTAGTAAACCTTCATGT*CTTGTTAAGTTCCCGATACATGTTTGCGTCTGTAGAT*CTTACT
TATAATCAAGTCAAAT*CCTCGGGCCCCTGTGCTG*CCTGAGGAGGTTTTCCTTTGTAT*CCCATGGACGAACTTTGTAGCCTGTTTTGCT*AAATCATT
ACAGAATCAAtgtgttttttcgacaaaaaaaaaa
page-top