Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15829  (registered. 2007)
Contig Information
Length 749 bp
Clones 32 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_dL Crown of seedling 8
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 4
Wh_r Root 2
Wh_yd Spikelet at late flowering 5
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytoplasmatic ribosomal protein S13 [Triticum aestivum]
Score 762
Evalue 3.76339e-79
Total Hit Count 324
Registered year 2007
Contig Sequence     [ Download ]
>Contig15829
tttttttttTAACTGACAAAAT*CTGGGTACATTATAACAGT*CGTTTAACAG*ACAG*AACA*GTGAAACCATAAAGGTTTTACAGCATCCTCCAGGCA
AACAGAGAAAATTTGCAGCATCTGCTTGGCTCCAAACTATCATAAAGCATTACATAAGAATGGTTTCCAGAACAATCAAGCTTTAATCAGCTAAGAGCAC
ACCAGATCTGGATCTCCCTTAAGCCACCAGAGTGCTGGCGGTGGTAGACTCGTACTTCCAGGTGGGCGGGAGCTTCTTGGTGCGCTTGTAGTAGCGAGC*
GAGGCGGTGGATCCTGCTCTCCACAAGGATGAGCCTGAACTTAGAGTCCTTGTCCTTCCTGTTCCTCTCCAGGTGCTTCCTTATCGCCACCGCCTTCTTG
ATCA*GAAAGTAGAGGTCCTCCGGGATCTCTGGTGCCAGCCCATGGGCCTTGAGGATGCGGAGGATCTTGCTCCCGGTGACGCTCTTGACGAGGGGGATG
CCGTGCTGGTCACGGAGTAGGACGCCGATCTGCGACGGCATCTGGCCCTTCTTCGCGGCCTTGGTGATTAACTCGTCCACATCGGCGACGGCGGTCTTGA
CCCAGCTCGGGGGAGTCC*T*CTTGTACGGCAGCGCCGACGACGAGATGCCCTT*CCCGCGGCTGTGCATGCGCCCCATGGCTGCGGCTGCTGCGGCGGC
GAGGGGAGTGGCGGCGGCGGCGGCGggaagggcgcctcgtccgaattcc
page-top