Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15816  (registered. 2007)
Contig Information
Length 2427 bp
Clones 32 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 5
Wh_f Spike at flowering date 10
Wh_h Spike at heading date 8
Wh_r Root 2
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Plasma membrane ATPase; AltName: Full=Proton pump >gi|45268533|gb|AAS55889.1| plasma membrane H+-ATPase [Triticum aestivum]
Score 3357
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15816
ctatgataTTTATAGACGAG*AATTGTCTTTGTATAAACCCATGTG*ATGGGATAGCAAG*CATGTGGCAGAAAATTTGCAGTGATT*ATTTCTCGTCTT
GCTTCCGCAAG*ATCACCGACTAGTTAGGGGAAACTGGGTAAAACGCGAAAACGATTACAACCACGCCGTGCTCCAAACACGGTATAACTCCACTAGAAC
ATTAAAACCTCTCTAG*AAGACGGACAACCGAAACCATATATTTGGTAGCACTTTACAACTAGGGGCTGGT*CAG*ATCAGCCATGTTTGTTTCATTCAT
TCACCGGAAAAA*TCTTAAAGCGGAGCTCCATTCCAATCTAGCTCCAACACGG*ATGTCATGTTTGTTGGTT*CAATGTCCAATTTCCTCACACGGTGTA
GTTCTGGTTGATGGTGTCGATGTCAAGGCCCTTGAGCTTCACCACGG*ATTCAACGTGGCCCTTG*AGTGTGTTGAGCTCCCTCAACCTTGCAATCTCAG
CTCTTCTCTTTGCTTGCTCAGCGATCTCAGAGAGCTCACGGTAGCTGCTCTTGTCGTTGAACAGTGTGTGGGAGGCCGGCTCCGGTGCTTGAAGGCCATG
GAGTGTTCTCTGTGCGGTAGCCCATTGTGCTTCCCTCTCCCCTTTGCC*GTAGTTC*TC*TTTGGTGGTGAAAGCAGTCTTGTTCTGCAGGAGGTTGTCC
CAGGCCCTTCCACTCAGCACAAATCGGATGAAGAACTTGAAAATGTCGAGTGGGAAGTAGAACACAATGCTGAACAGCCAGATAACACCAGCCCAGCCCC
ACCCGATTCCCTTAATCCTTGCGAAGTCCCAGTTGGCATAGACAGCGATGAGTGTTGCAACCAATTGTGCGAGGAGGAAGGCGGTAACCAAGAGGAAACC
TGGGCGCTCAACAAAGGACCAGCTACGGGAACGAGTCACAAAGATAAGAGCCTGGCTCACAATACTGACTTGGAGGTACAGTGCAGACATCTCCTTAAAT
TCGGTGTTCCTGATTGACTCGACACCGAATTTGTTGGTGAAGAAGTCTGTCTTGTGGATGAGCCAGAAGAAGACGACAGTCACCAGAGCAAGGTAGGTTC
CCAGCACAACACCAGTGGCGAAGATTTCATTGAGCTTCCAGCTGTCGGGCAAGGGAGATGGCTTAACTCTGT*CCTTGGATATTGTCATGATAGTACCAT
CATTGAGAATGGCAATGATAAGGACCATGAAGGGAGCGAAATCAAATTT*CCAG*ATCAGGGCAATAAGCATAAAGCCAAGCACAATACGGATGGTGATG
GAAACTGCATAGATCGTGTAGTTCTTCATCCTCTGAAAAATGCACCTGCTGGTCAGGACAGCACTGATAATGACACTGAGACCTGGCTCGGTAAGCACAA
TGTCTGAAGCACTTCGAGCAGCATCTGTAGCATCATCGACAGCAATACCAATGTCGGCCTTCTTAAGAGCAGGAGCATCATTGACACCATCGCCAGTCAT
ACCAACAATGTGCTTCTTCTCTTGCAGCCTCTTCACAATCTCATACTTGTGCTCAGGGAAGACTCCGGCAAATCCATCAGCCTTCTCAATCAGCTCATCA
ACAGGAAGTGACTCAAGTGAACCGTCCTTGCTTTGGCCAAGCAATGCAGAAGAAGGATACATGTTTGTGCCCATCCCAAGCCTCCTACCAGTCTCCTTTC
CAATAGCAAGTTGGTCACCTGTGATCATCTTGACGTTGACACCAAGAACAAGTGCCTTGCGGATGGTCTCAGCACTGTCATGCCTTGGGGGGTCAAACAG
GGGCAACAGACCAATGAATTGCCATGGTCCACCAGGAGAATCCTTGGATTTCTCGGGTACTTCCTGTCTCGCAACAGCAAGCGAACGAAGCCCACGCTCA
GCATACTTCTCAATCACAGAGTGCACCTTTCTCTTCACATCCTCCTTGCAGTTGCAGAGGGTAATAATCTGCTCAGGAGCACCCTTGCTGGCACGGTGCC
AGTTACCCTCAGCATCGATGTAAGTCAGAGCAGTCCTCTTGTCAGTAGGGTTGAATGGCAAGAAGTGCACTTCCCTGATGCCAGCTCTTGCCTCCTTAGG
ATCAGCAAGCATACCAACCATGCAAGCATCAATTGCATCCTGGTTTTCAACCCTTGAAGCCCTTGCAGCCAACAACAGCACATGTTCTTTGTCGACACCT
TTCGCAAACACCTCAACCAGGTTCTTGTCAACACTGAGCTTGTTAAGGGTGAGTGTGCCAGTCTTATCACTGCAAAGCACATCCATGCCAGCCAACTCTT
CAATGGCAGTCATCCTCTTGGTGATAGCACCCTGCTGGGACAACTTGTGGGAACCAAtagccatggtgaccgacaaaactgtaggcatggcaatcggaat
accaccgatcaagaggaccaacaggtc
page-top