Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15766  (registered. 2007)
Contig Information
Length 1107 bp
Clones 30 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 2
Wh_r Root 11
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit delta tonoplast intrinsic protein TIP2;3 [Triticum aestivum]
Score 1164
Evalue 6.23842e-133
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15766
aggaattcggcacgagggaaacATTCCGTCTCATCCTCCCCAGCTCGGTTTTTGGGCCATTCTAAGCCACCATGCCTGCCTCCATCGCCTTCGGTCGGTT
CGATGACTCCTTCAGCTTGGCCTCTTTCAAGGCCTACAtgcGCCGAGTTCATCTCCACCCTCATCTTCGTCTTCGCCGGCGTCGGCTCTGCCATCGCCTA
CTCCAAGGTGAGCGGCGGCGCGCCGCTTGACCCATCCGGGCTGATCGCCGTGGCGATCTGCCACGGGTTCGGGCTGTTCGT*CGCGGTCGCCGTCGGCGC
CAACATCTCCGGCGGCCATGTGAACCCTGCCGTCACCTTCGGCCTCGCCCTCGGCGGCCAGATCACCATCCTCACCGGCATCTTCTACTGGGTTGCCCAG
CTCCTCGGCGCCATCGTCGGCGCCTTCCTCGTCCAGTTCTGCACC*GGCGTGGCGACCCCTACACACGGGCTTTCC*GGCGTGGGCGCCTTCGAGGGCGT
CGTGATGGAGATCATCGTCACCTTCGGGCTCGTCTACACCGTGTACGCCACCGCCGCCGACCCCAAGAAGGGG*TCCCTCGGCACCATCGCTCCAATCGC
CATCGGCTTCATCGTCGGCGCCAACATCCTCGTCGCCGGCCCCTTCTCCGG*CGGGTCCATGAACCCTGCACGCTCCTTCGGCCCCGCCGTTGCCAGCGG
CGACTTCACCAACATCTGGATCTACTGGGCCGGCCCGCTCATCGGCGGTGGCCTCGCCGGCGTCGTCTACCGGTACCTGTACATGTGCGACGACCACACC
GCCGTCGCCGGCAACGACTACTAAGCCAGCCATGGGAAGATCATTCGGTCTTTGGTTTCCATAATGTCTTCGGCAACATAAGAAGTGCGTACGTGGTGGT
CACTCTCAGGATTGTCTGGATGATGTGAGGAACGTCATGTTGTTTGGTTCCGATCGAAAGCCCGCGAGGCTGTGGCACTTGGATGATGCATGTTTCTGTA
TCTGTACTGTGATGGATGTTGTG*AAGTTGTTGGGGTTTCAAGATTCTTCAGTTGAGTTTCCTTATGCGATTCAATAAGAGCATCATTGTTTAGTGcaaa
aaaaaaa
page-top