Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15754  (registered. 2007)
Contig Information
Length 838 bp
Clones 29 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 10
Wh_SL Seed DPA30 4
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 3
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GA27418 [Drosophila pseudoobscura pseudoobscura] >gi|198132593|gb|EDY68336.1| GA27418 [Drosophila pseudoobscura pseudoobscura]
Score 73
Evalue 0.124658
Total Hit Count 47
Registered year 2007
Contig Sequence     [ Download ]
>Contig15754
ttttttttttgaacaagggcAGGGTCCAAAAGGACCCCAG*ACTTTATTTGATATTACAATACCGTAGTACAAG*CCAGAACAACAGGACACACAACAAA
CTGAAAATTACAAAGCAGTCCCTGAAATATGCAGAAAGGACCCCAAAGATCTGAAGAGGAACGCAATCAGGTCCAAGCCACTCCCGATCGACTCCAAA*C
TCGCCGGCTCCGGGGACATCACC*ACTTGGTCCGACGAGTTCTTCACCGCAGCAAGCCATGAACATCGATCTAGAGTAGCACTGCCTCCCATATAGCTTC
AAGGCTAGGAGGAAGAGGTTTGGCCGCCCTTCGGCCAGAGGATTCGGTGGCGCGGCGGCGCTGCAAGCCGGCTGTCCGCCGGGAGCGCCAAAGCTCAAGC
ACCATCGATGATTTGCTCTGGAACCGGTCGCAAGAACAGTCTTCATACCAGTCCCTGTCGACTTGACCACCACCATGGTGACTGCCGTCGGCGAGAGCAA
GCGAAGGGGATTCCTGCATACCAGGGG*AGACATCGAGCTTATTTCCGAGGATTCCAGCGCGCCTGCTTCCAGCAGCAGCGAGCCAACCGCCACCACCAA
CAAGAGCATCGCCAGGAACCACCGAACGCGGCTCGGGCGCGCCGACAGCAAAATCCTCATCGGCATGACGCCAATCTCCGGCACTAGGCCAAACTCCTCT
AAGGAAAAACTAG*AACTACACCTACTAGATACTATAGAGCACCGCGCACCTCCCCCATCACCTCTCCAACCGGCGTCGCCGGCGGCGAAGATCCGGGAT
CGGGCCGGGCCTGAGCTGCTTTTGTTTTCGCCtctccc
page-top