Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15745  (registered. 2007)
Contig Information
Length 809 bp
Clones 29 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 8
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 4
Wh_oh Pistil at heading date 7
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0127900 [Oryza sativa (japonica cultivar-group)] >gi|115487104|ref|NP_001066039.1| Os12g0124200 [Oryza sativa (japonica cultivar-group)] >gi|122246371|sp|Q0IQF7|RS16_ORYSJ 40S ribosomal protein S16 >gi|158513344|sp|A2ZB00|RS16_ORYSI 40S ribosomal protein S16 >gi|77548488|gb|ABA91285.1| 40S ribosomal protein S16, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|77552917|gb|ABA95713.1| 40S ribosomal protein S16, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113644336|dbj|BAF27477.1| Os11g0127900 [Oryza sativa (japonica cultivar-group)] >gi|113648546|dbj|BAF29058.1| Os12g0124200 [Oryza sativa (japonica cultivar-group)] >gi|125533236|gb|EAY79784.1| hypothetical protein OsI_34940 [Oryza sativa Indica Group] >gi|125535625|gb|EAY82113.1| hypothetical protein OsI_37311 [Oryza sativa Indica Group] >gi|125576049|gb|EAZ17271.1| hypothetical protein OsJ_031480 [Oryza sativa (japonica cultivar-group)] >gi|215765083|dbj|BAG86780.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765331|dbj|BAG87028.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215768293|dbj|BAH00522.1| unnamed protein product [Oryza sativa Japonica Group]
Score 726
Evalue 6.47336e-75
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15745
attcggcacgaggcccgacccgcgccgcctCGCCGCCGCACTGCCGCAACCAA*G*CACACCACCG*CCCTCACAGCAACCAA*GCACACC*AC*CG*CC
CTCACAGCAACCAAGCACACGG*CCGCAGACACCATGGCAGCCGTTCTCACTCGCCCGACGCCTGGCACTGTCCAGTGCTTCGGCCGGAAGAAGACCGCC
GTCGCCGTGGCCTACTGCAA*GCCCGGGCGCGGCCTCATCAAGGTCAACGGCGCGCCCATCGAGCTCATCCGCCCCGAGATGCTCCGCCTCAAGGCCTTC
GAGCCGATCCTGCTCGCCGGTAGGTCGCGCTTCAAGGACATCGACATGCGGATTCGCGTCCGCGGCGGCGGGAAGACGAGCCAGATCTACTCCATCCGCC
AGGCCATCGCCAAGTCGCTCGTCGCCTACTACCAGAAGTACGTCGACGAGGCGGCCAAGAAGGAGGTGAAGGAGATCTTTGGTCGCTACGACCGGACGC*
TCCTCGTCGCCGACCCGCGCCGCTGCGAGCCCAAGAAGTTCGGCGGTCGCGGCGCCCGCGCGCGTTTCCAGAAGTCTTACCGTTGATCTCCTGCGAGAAG
TCCTCTTGGGTATGGCGGTGGTGGCGTACTGCTTGTCTACTTATCTATCTACCTTTTGCGGCTAGTAGTTTCCTATC*TTTTGGTCAATGAAATGG*ATT
GTGAGGTGCCCGTGCAATATCATTTTGCTTCATGCCTAGTTAAAGGGATTATGCTATGTTTATCTTATGTTAATGATGAGacggacgttcagnataaagt
tttcttaat
page-top