Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15733  (registered. 2007)
Contig Information
Length 649 bp
Clones 29 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_SL Seed DPA30 14
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 3
Wh_r Root 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein l34 [Triticum aestivum]
Score 488
Evalue 1.64184e-47
Total Hit Count 307
Registered year 2007
Contig Sequence     [ Download ]
>Contig15733
ttttttttttggaGTCCAAAAGCTCTTGCATCAAAGGCTAAGCATCCATAGAGAACCAGCGCGCAAAATCTAGAGAAGCACATCAAA*CCTCACATACTA
G*AACCAGGATTCAGCAAATCCGAAG*AGAGAAAATTCTTGATTGCTTAAAACAAATTCGAAG*AAACACAAAACATCACCGCGACGCCTATATCGCCCA
GTTGTTTAGCTCTTGGTGGTCTTCTCCTTGGTCTTCTGGATCTTCAGCACCTTCTTCACAATCTTCTGCTCCTCCACCAAAAACGCCCTGATGATCCTCT
CCCTGACTGCAGGACCAGACAG*AACACCACCATAAGGACGGTTCACAGTCCTCCTGTTCCTTGACAATCTGGACCTCTTGTACTCAGTAGGCCTCAGGT
GTGGAATTCCTTGGATCTTCTTGCCGGTAACCGGGCATTTTGGCCCACTCGCCCGCTTCTTGGTGTACTGGTACACAAGCCTCCCACCTGGGGTCTTGAC
GACGCGAGTCTGGTTCGACTTCGTGGCGTAGCTGTGGCGCTTTCGGTATGTCAGCCGCTGCACCAT*CTCGCCGCCCT*CTCCCGGAGTTCTCTCACCGC
TCGCT*CTTTCGCTCCCGCTGTCTGTAACGAGGCGgcctcgtgccgaat
page-top