Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15714  (registered. 2007)
Contig Information
Length 903 bp
Clones 28 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 8
Wh_e Seed DPA10 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 5
Wh_r Root 2
Wh_yd Spikelet at late flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytoplasmatic ribosomal protein S13 [Triticum aestivum]
Score 762
Evalue 5.29141e-79
Total Hit Count 327
Registered year 2007
Contig Sequence     [ Download ]
>Contig15714
ttgaCCAAAAAGTGTGCGGCCACTTTTTAGATTTCAGGATAACCATATAGTCAAACTGTCCAAGCTTGAGTGCACTGAAAGCAGCGATTACACTCACTCA
GATCAGACAACACGAATATCACAATGTCTAATTTTAACTGATGAATTGTAGATAGACGCTAAACAG*AACCAGACAGAATTGCAAAACCAAAAATGGTTT
ATGGGATTCTCCAAGTAAACATAGAAAATTTGGTCTCTTGTTCATCTAAATCGCTCCAAACTCAAAAGCGTTACATGAAATTGATAATATGTAGAACAAG
ACCATCCTGAAGCCGGTAAGAGCACACCAGATGAAGAGCCCTCCTAAGCCACCAGA*GTGCTGGCAGTGGTAGACTCGTACTTCCAGGTGGGCGGGAGCT
TCTTGGTGCGCTTGTAGTAACGGGCAAGACGGTGGATCCTGCTCTCAACAAGAATGAGCCTGAATTTGGAGTCCTTGTCCTTCCTGTTCCTCTCAAGATG
CTTCCTAATGGCGACAGCCTTCTTAATCAAAAAGTACAGATCCTCTGGGATTTCCGGCGCCAGGCCATGAGCCTTGAGGATGCGGAGGATCTTGCTT*CC
CGTAACGCTCTTCACGAGGGGGATACCGTGCTGGTCACGGAGGAGAACGCCGATCTGCGAGGGCATCTGACCCTTCTTCGCAGCC*TTCGTGATCAACTC
GTCGACATCAGCGACGGCGGTCTTGACCCAGCTCGGGGGAGTCC*TCTTGTACGGCAGCGCCGACGACGAGATACCCTTCCCGCGGCTGTGCATGCGCCC
CATGGCGTCAGGCGA*GGGGTTTAGCT*CCGGCGACGGCGGCGTCGGTTGCCTGCAGCAGCGGCGGCGCGAAGGGCGAGAGGGG*CTCGAGCCtcgtgcc
gaa
page-top