Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15707  (registered. 2007)
Contig Information
Length 2459 bp
Clones 28 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 4
Wh_r Root 2
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_001238 [Oryza sativa (japonica cultivar-group)]
Score 3436
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15707
agactaaaaccttcaaggtggagctgagttttgcagctagaatccccatgagtgctattgcaatggcactcaaaggccaggaatcagagcacacgCAAGA
AgccattcGGGTTATTGATatcatATTAAGACAACACTCTTCCAAACAGGGCTGCCTGTTAGTCCGCCAGTCATTTTTTCACAACAATCCTTCAAACTTT
GTGGACTTGGGTGGGGGTGTGATGGGCTGCCGAGGTTTCCACTCAAGCTTTCGAGCCACACAGAGCGGGCTTTCTCTTAATATTGATGTTTCTACAACAA
TGATTGTGAAACCTGGCCCTGTTGTTGATTTTCTGCTGGCCAACCAGAAGGTTGACCACCCTAATAAAATTGATTGGGCTAAGGCCAAGCGTGCACTTAA
GAATTTAAGGATAAAAACAAGCCCAGCAAATACAGAATACAAGATTGTTGGTTTGAGTGAGAGGAATTGTTATGAACAGATGTTTTCCCTCAAGCAAAGG
AATGGTGGGAATGGTGACCCTGAAGCAATAGAAATATCTGTTTATGATTACTTTGTGAAGAACCGTGGCATTGAGCTGAGGTACTCTGGTGATTTCCCTT
GTATAAATGTTGGGAAACCTAGGCGGCCAACATATTTCCCCATTGAGCTCTGCCAGCTGGTGCCTTTGCAAAGGTATACCAAATCTTTGAGTACCCTACA
AAGATCATCTCTTGTTGAGAAGTCCAGGCAGAAGCCTCAAGAGAGGATGTCAGTTTTGTCTGATGTACTGAAACGCAGCAGCTATGATACAGAACCCATG
CTGAAGGCATGTGGAATTTCGATAGCTCAAGGCTTTACTCAA*GTGTCTGGTAGGGTACTGCAGGCCCCCAAGCTCAAAG*CTGGAAATGGTGAAGATAT
TTTCACAAGGAATGGACGTTGGAATTTCAACAACAAGAGGCTTGCTAGAGCTTGCGTGGTTGACAGATGGGCGGTTGTAAACTTTTCGGCTAGGTGTAAC
ACCATGAACCTTGTCAATGACCTCATCAAGTGTGGGGGCATGAAGGGCATTACAGTAGAAAAACCTCATATTGTAATTGAAGAGAATGGTTCAATGAGAC
GTGCACCTGCTCCAAAAAGGGTTGAGGATATGTTTGAGCAAGTGAAGTCTAAGCTTCCTGGGGCTCCCAAGTTTCTCTTGTGTATTCTTGCTGAGAGGAA
GAACTCAGATGTTTATGGTCCATGGAAGCGAAAATGCCTTGCTGACTTTGGGATTGTCACTCAATGTGTGGCCCCAACAAGGGTCAATGACCAATATCTG
ACAAATGTTCTGCTGAAGATCAATGCAAAACTTGGTGGAATGAACTCACTGCTACAAATTGAAATGTCCCCAAGTATACCTCTTGTATCAAAGGTCCCAA
CTCTCATCTTGGGAATGGATGTGTCCCATGGATCCCCTGGACAGTCTGATATACCATCCATTGCAGCAGTTGTTGGTTCTCGGGAATGGCCTCTTGTCTC
GAAATATAGGGCTTCAGTGCGCTCGCAGTCACCAAAGCTAGAAATGATAGATTCATTGTtcaagccacaaggaactgatgatgatggccttgttcgggag
tgtctcattgacttctacaccagttctGGAAAAAGGAAACCAGATCAGATCATCATCTTCAGGGATGGTGTTAGTGAGAGCCAGTTTAATCAGGTGCTGA
ACATTGAATTGGATCAAATAATTGAGGCCTGCAAGTTCTTGGATGAAAATTGGAACCCCAAGTTCACGCTGA*TTGTTGCCCAGAAAAA*TCACCACACC
AAATTCTTCATACCTGGATCTCCTGACAA*TGTCCCTCCAGGCACTGTTGTAGATAATGCAGTCTGCCATCCAAGGAATTATGACTTCTACATGTGCGCT
CATGCTGGAATGATTGGGACTACAAGGCCAACACAC*TACCATATCCTGCATGATGAGATACACTTTGCTGCGGATGACCTGCAGGATCTTGTGCACTCG
CTCTCATATGTGTACCAAAGGAGCACGACAGCCATATCAGTTGTTTCTCCAATCTGCTATGCACATCTTGCGGCTGCTCAGGTGGCGCAGTTCATAAAGT
TTGATGAGATGTCTGAGACGTCGTCGAGCCAGGGCGGTGGCCACACCT*CTGCCGGCAGCGCTCCAGTGCAGGAGCTGCCTCGCCTCCATGAGAAAGTCC
GCAGCAGCATGTTCTTCTGCTGAGCCAGCCAGCCAGCCGCACTTGCGCGTTCCAACTTTTGGTGATGCGCTTGGTTATCTAGTACTAGTAGTATGTAGTA
GTGGCCTGTGATGGCCTGTTGGACT*CCTGGGATGTTGTGTT*CCTAAGCTGGTTGCTGCACTTGGTGCCTCAGAACCTTTGAAT*CCTGTCAGGGTGCT
GCAGTTGAACCTTTACTATCGAACCATCTAATTTGTTGCTTTCcatctcaaaaaaaaaa
page-top