Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15697  (registered. 2007)
Contig Information
Length 665 bp
Clones 28 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 9
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 1
Wh_r Root 4
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L44 [Zea mays] >gi|195606184|gb|ACG24922.1| 60S ribosomal protein L44 [Zea mays] >gi|195620316|gb|ACG31988.1| 60S ribosomal protein L44 [Zea mays] >gi|195623550|gb|ACG33605.1| 60S ribosomal protein L44 [Zea mays] >gi|195656257|gb|ACG47596.1| 60S ribosomal protein L44 [Zea mays]
Score 422
Evalue 7.87786e-40
Total Hit Count 311
Registered year 2007
Contig Sequence     [ Download ]
>Contig15697
ttttttttttcatgagcatacactgcgacagcaattctaatcagaccaagaacaaagatACCGCACTCCGAGCATAAACAACATTTTACTTGTCGATTAG
ATCTGGAGAAAGTAGTTGACACAATAGCAAAACATATGCTCCATAGCCCATAGGGTTATAACCAG*AAAATTAAAGATAATACATTCTTCTTGTGGGAAG
TTCTGGCACAACATCCTAAACATAACAGGATACCATCAGCTTAGAAGAGAGATGTTCCCTTGCCCTTCTTGTCTCCACCGATTTCAAAGTGCTTGCACCT
CTTGATAGCGCGTTGTGAGTAATGCTTGCAGCTCTGGCACTGCAACTTCAGCACAATCTTCTTTGTTGTCTTGGCCTTCTTGTGGAAAACAGGCTTTGTC
TGGCCACCATATCCAGACTGCTTGCGGTCATAACGACGCTTCCCCTGAGCAGAAAGGCTATCCTTGCCTTTCTTGTACTGGGTAACCTTGTGGAGCGTGT
GCTTCTTGCACTCCTTGTTCTTGCAGTAGGTCTTCTTGGTCTTCGGAACGTTCACCATGGCTGCGGAAGCGGCGGTGGATCCGCGACGACGACGGCGAGG
AGGAGGAGTGCGCG*CCTGGGTGAGAACACGAGGAGTGCG*CCTCGTGCCGATTCGGCACGAGgc
page-top