Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15695  (registered. 2007)
Contig Information
Length 1901 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 5
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit elongation factor 1 alpha [Zea mays] >gi|7230389|gb|AAF42978.1| elongation factor 1 alpha [Zea mays]
Score 1081
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15695
gctagaacccgccgccatgggcgcgccgctcttcggcgccgtcctcctctgcctggtactcgccgcggcggcggtgcagcagcccacattgccctcctct
tcagcggccaacagctccacgggggtgaactccaactcggtgctggtggcgctgctggactcgcactacacggagctggcggagctggtggagaaggcgc
tgctgctgcagtcgctggaggacgccgtggggcggggcaacgtcaccatcttcgcgccccggaacgaggccctcgagcgggacctcgacccggagttccg
cgccttcctccttgagccccgcaacctgcgctccctccagcgcctgctcctcttccacgtcctccacctcccacctcatcgCCGCCGCAGGCTTTG*ACT
CCAT*CGCCTCCTCCCTCCTCCTCTTCGTCTCCGGCAGGCCAGGTAGTTAACAGCTCCAGCAGCCATGGGAAAGGAGAAGATCCACATCAGCATTGTGGT
CATTGGCCATGTTGACTCTGGCAAGTCAACCACGACTGGCCACCTCATCTACAAGcctTGGAGGCATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGA
AGCCGCTGAGATGAACAAGAGGTCTTTCAAGTATGCCTGGGTGCTTGACAAGCTCAAGGCTGAGCGTGAGAGGGGTATCACCATTGATATTGCTCTCTGG
*AAGTTCGAG*ACCACCAAGTACTCCTGCACTGTCATTGATGCTCCTGGTCACCGTGATTTCATCAAGAACATGATCACTGGGACCTCCCAGGCTGATTG
TGCTGTGCTTATCATTGACTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAG*ACCCGTGAGCACGCTCTCCTTGCGTTCACTCTTGG
TGTGAAGCA*GATGATCTGCTGCTGCAACAAGATGGATGCCACCACTCCTAAGTACTCGAAGGCCCGTTATGAAGAAATTGTCAAGGAAGTCTCTTCATA
CCTGAAGAAGGTCGGTTACAACCCTGACAAGGTTCCCTTCGTTCCCATCTCT*GGGTTCGAGGGTGACAACATGATTGAGAGGTCCACCAACCTTGACTG
GTACAAGGGCCCCACCCTTCTTGAGGCCCTGGACCAGATCAATGAGCCCAAGAGGCCCTCCGACAAGCCCCTGCGTCTTCCCCTTCAGGACGTCTACAAG
ATTGGTGGCATTGGAACTGTGCCAGTGGGggcGTGTTGAGACTGGAGTCATCAAGCCAGGCATGGTTGTCACCTTTGGTCCTACTGGCCTGACCACT*GA
GGTGAAGTCTGTGGAGATGCACCACGAGTCTCTCCTGGAGGCGCTTCCTGGTGACAATGTCGGCTTCAACGTCAAGAACGTGGCCGTCAAGGATCTCAAG
CGTGGATACGTCGCTTCCAACTCCAAGGACGACCCTGCCAAGGAGGCTGTCAAGTTCGCTGAGATCCAGACCAAGATTGACCGGCGGTCTGGCAAGGAGA
TTGAGGCGGCGCCCAAGTTCCTGAAGAACGGTGATGCCGGGTTCGTCAAGATGATCCCCACCAAGCCCATGGTGGTGGAAACCTTTGCCCAGTACCCTCC
CCTGGGCCGGTTTGCTGTGCGCGACATGAGGCAGACGGTTGCCGTGGGCGTTATCAAGGCCGTGGAGAAGAaggatccgaccggcgccaaggtgaccaag
gctgcggccaagaagaaatgagatggtgtcaggttctttactgcatctatggtggtggtggcggtggcggtatttggtggtggtgatagttgttctagtc
gttttgagaacttgttaagcttcggttatttgtgtcgagcagtgttggaactgcttattgctctggtcattgtatcgttcggttgtgttggggaactatg
t
page-top