Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15679  (registered. 2007)
Contig Information
Length 719 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_SL Seed DPA30 10
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194703792|gb|ACF85980.1| unknown [Zea mays] >gi|195615288|gb|ACG29474.1| 60S ribosomal protein L18a [Zea mays] >gi|195627346|gb|ACG35503.1| 60S ribosomal protein L18a [Zea mays] >gi|195627434|gb|ACG35547.1| 60S ribosomal protein L18a [Zea mays]
Score 914
Evalue 8.14072e-97
Total Hit Count 309
Registered year 2007
Contig Sequence     [ Download ]
>Contig15679
tttttttttTGTCTTTAACCGATAAATAAG*CAACAAAACGCTTGTCTTCATGCATCAG*AAGATCCAACATACGAAGAAAACATTTCAACTCTTAACAG
CATCCACCACA*GC*CCAATCACATGAACAAGTTCGGCCTCGTTGCCTTGTAGGTGGTCTTCAGCTTCCTGGTTGGTGGCCTGACCTTTTGGTACACAAG
GGGGAACTTGATCTTGGAGTTGTGGAACTGCTTGGTGTTGTCTCTCTTGCATAGCTTGAAGTTGACAGTCGCGGTCTTGATGATCTGAATGCAGGGGGAT
CTCACACGGTGGCGAGAGGCCATCTCAGTGTACATCTGCTCCACGGCACCATTTAGTGTGGTGTCACGGTACTCCTTGTACATGTTGTGGTAGCCAGTCC
TGCTCTGGTAACGCAGCCAAATGCCATAGTTCTTGATCGTGGTTGGGTTCTTCTCAAAGATCTCGTTGATGGCGAGCATCTGGCCGTTGCTCTTCTTCAC
CTTCTTCAGCTTCCTCAGGAAATACCAGAACTTGCTCTTGGCGCGGACCTCATTGGTGGCCCAGAGCTTCATGCGGTAGATCTTCGGCTGCTCATCGCCG
GG*CGTCGGCAGCGCACGACCCACCACCTGGTACTGATGGAACCTGAAGGCCACCATTT*CCGCGAGC*T*CTGTGAAGCCCCTAGCCTAACCTAACCTA
AGGAGATGGGGAGAGCAgc
page-top