Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15676  (registered. 2007)
Contig Information
Length 759 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 8
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 3
Wh_oh Pistil at heading date 10
Wh_r Root 4
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Acyl carrier protein 3, chloroplastic; AltName: Full=Acyl carrier protein III; Short=ACP III; Flags: Precursor >gi|166971|gb|AAA32922.1| acyl carrier protein III
Score 645
Evalue 1.40589e-65
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig15676
acACATgcngatgcAGTTGGCTCGTACCCGCATATT*CTTCTTTTTGGGCACAAAAG*ATGCATACAT*CTACATGCACCACAGCCGCACGAAAACTAGG
CACTTCGATGTTCAACAGCTTACATACTTAACCAATTATCTTATTACACACAGCAGG*AGACGATAGTCCTGAGAAAATCACC*AACCCACCATATAATA
ACGACTATGGTAGAACAACAAGGATCAACCCAAGGTAGGACTACTAGCTTACGAGCTCCAATCATTACGATTTACGACCTCCCTTCAAGATGACTTCGCA
GAGACAAGCTTGTCGATGAGCGTGGCAGCATCTTCAACTGTCGCAATTGCCTGCGCACTCGTCTCCTCCACGCTGATCTGGAACTCCTCCTCGAGGCCCA
TCACAATCTCGACCGTGTCCAGTGAATCAGCTCCAAGGTCAGAGAACTTGGTGGTACCGCAAACTTCAGTGCCTTCAGGAACAGCAAGCTGCTTCTTAAC
AATTTCACAAACCTTCTCCACTGTATCCTGCTTTGCTGAGCAGCAAACAGCAAATCTCATCGGCACTGGCTGCAGACGAAGAAATGCATTGCCCCT*CCT
TGCACCAGAGAAAGAGAGCGAGTT*CGTGTTGATTGCCTTGACGGGCTTGGCGAAGGACACGGCAGATCCGGCGATGGAAGCCATGAGGCAGCACGCGAA
GGGAGGCG*GCGAGCACGAAGA*GCGTGAGAGCG*ACGGGGGATGGACTGGGtgggtgc
page-top