Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15674  (registered. 2007)
Contig Information
Length 1284 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 2
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit histone deacetylase HDAC2 [Triticum aestivum]
Score 1054
Evalue 1.24708e-112
Total Hit Count 285
Registered year 2007
Contig Sequence     [ Download ]
>Contig15674
tgatgacctgcattcaccaaccattcaatTCCGAAT*ACAGCGGCTTTTTTGTT*CGATTCAACAACAAACGCATCAACACTAACAGCTCAACGGTTT*C
TCCCTTCCCTTCCCTCGGG*ATCAGGCTAGGTAGGTACGACAACATAATAAGATATAGCAGATAGCCTAACACAGCAGCATAACGATAATAATCTCAATA
GGGCAGACAGATCAAAATAATAGCAACTGGAGCCAGCCAGCCAGCCAACACCTTCCTCTCCTCTTCACTTGGCCTCGTGCTTTGCCTTGGAGTGCGAAGC
TAGAGCGCCCTCGCTGTTGAATGTCTTGCTGCACGACTTGCACGCGACCGACCCTCCAGACTTGGGCGACTTGTCGCTGGTAGCCGGGGTCTTGCCTGCC
TTCTTGGCCGGGTGAGGAGTCGCCACATGGACAGCTCCCTTCTTGTCGCCTGTCTTCTGGCCTGACGGTGTTGCAATCTTGGCCTTCTTGTCA*GTAACA
GGGG*TCTTCAACACGCTTCCAGCCGCCCTCTTCTTCCCAGTCTCTTGCTTCTTGGGTGTTTCTTCTTCCTCCTCATCAGAGCTATCCTCACTATCATCA
GAGGAATCATCACCGCCCTCACTATCATCAGAATCATCCTCCATGGGAATCAATGCTCCATCATCACCAGAGTCATCTTGGCTGTCATCCTCATCACTGT
CATCATCATCATCGCTGTCATCATCCTTGTTAGATTTTCCCCCATCCTTAGCAGCAGGCTTGGACTTTGAAGGGGCAGCAGTGTCAATCTTAACCTGCTT
CTTCTGCTCCTTGGCTTCAGGTTTGCCATTCTCCTTGGTGAGTGCTGGAATGATGGTGTCTTGCTCCTCCTCAGACTCTTCCTCGGAATCAAAATCCATC
TCATCTCCGTCGGCAGGCTGGAAAACCTTGTAGCCAGAGAAGAAGACGCTGGACGTCTTGGAATTGTGTGAGAGCTCAAACTCCTTCTCAAAGACGAGGT
CGAA*CTGGATCTGAGGGAACTTGTCAGTAGAGAGGGTCCCGATGGCTAGCTTCTGGTCGCCAAT*CTTGACGAACATGGTAGCCTTGTCATCCTTCTTG
ACTTCACCAAGGGCACCCTGGGAGAGATGGAGGAAGTGGTCATCATCAGGTGAAACCTTGAGGGACTGGTTAGGCTTAACCT*CAAGGCCCCAGAACT*C
CATGTCAACCGGCGGCGGCGGAGGGTGGCGGCGGT*CTAGGCGGAGGGTGGCGGCGGagggcatGGGATGGgcctcgtgccgaa
page-top