Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15660  (registered. 2007)
Contig Information
Length 777 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 9
Wh_r Root 2
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0602600 [Oryza sativa (japonica cultivar-group)] >gi|51090885|dbj|BAD35458.1| unknown protein [Oryza sativa Japonica Group] >gi|113596048|dbj|BAF19922.1| Os06g0602600 [Oryza sativa (japonica cultivar-group)] >gi|125555971|gb|EAZ01577.1| hypothetical protein OsI_23611 [Oryza sativa Indica Group] >gi|125597783|gb|EAZ37563.1| hypothetical protein OsJ_021046 [Oryza sativa (japonica cultivar-group)] >gi|215768348|dbj|BAH00577.1| unnamed protein product [Oryza sativa Japonica Group]
Score 466
Evalue 8.56862e-45
Total Hit Count 65
Registered year 2007
Contig Sequence     [ Download ]
>Contig15660
gccaacCCCGTAACCCTACCCCGTATAAAACCCCGAAGCTGAgatAGGGCTTCCCCCcctCCGTCGCCGCCGAAATCTCTCTACTCCTGCTCCCCTCAAG
TCCCCGTAGCTAGCCAGTGTTGCTGTTCTCGCGCGGCCTCGGTGGCAGCCATGGAGGAGGTGACGGAGGCGGTGAACAACCTTACCATAGGGGAAGGAGC
AGCGGCGACGGCGGGAGCGGAGGGGCACAAGAAGAACCGCATCCAGGTCTCCAACACCAAGAAGCCCCTCTTCTTCTACGTCAACCTCGCCAAGAGGTAC
ATGCAGCTGCACGAAGAGGTGGAGCTCTCGGCCCTCGGCATGGCTATTGCAACTGTGGTGACTGTTGCGG*AAATTCTAAAAAATAACGGCCTTGCTGTT
GAGAAGAAAATAATGACATCTACTGTTGATGTCAAAGATGATACAAGGAACCGCCCTATCCAGAAGGTCAA*GATCGAAATATTGATTGGCAAGACGGAG
AAATTCGATGAACTGATGGCTGCCGCTGCAGAGGAGAGGGAGGCAGCGGGCGCTGAGGAAGAGCAAAGCTGAACACTTGGAAGGTTCCTGTTGTAGCTTA
ATTTTACTGTTCTTCTGCCCTTTGCTGTGTTTTAGTTTGTTGTGTCGACAAGAG*ACAAGTGCTTGCATAATCAAGTAAGGGCGCAGCTTATTTT*AGTG
CGCTTTTTGTTGATTTGTTAGGGTTACATGGCAACTTGTGATAATGGGATTATGAGTCTGATACGCTaaaaaaaaaa
page-top