Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15649  (registered. 2007)
Contig Information
Length 1388 bp
Clones 26 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 26
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Probable nicotianamine synthase 2; AltName: Full=S-adenosyl-L-methionine:S-adenosyl-L-methionine:S-adenosyl-methionine 3-amino-3-carboxypropyltransferase 2; AltName: Full=HvNAS2 >gi|4220596|dbj|BAA74582.1| nicochianamine synthase 2 [Hordeum vulgare subsp. vulgare]
Score 668
Evalue 6.54525e-158
Total Hit Count 183
Registered year 2007
Contig Sequence     [ Download ]
>Contig15649
tactatttgtgaactaaattatattcTCGACACTTAGACGTACAAAGGTGTACAAG*AAATTCGCGTGTAAACACCACACTTACATTATT*CGGTACTCC
CTCCGTTTGTTTTTATAAGACGTTTCGGACAGCTTGCTTTGTACTGTTATGAACAATGTCTGAATGTCTAAAACGTCGTATAGAAATAAACAGAGATAGT
ACAAACAACACATG*ACTTGAAATGCAGTAGTAGTAGTAGTAGTAGGAAAAATAACACGTACGGTTGCAAGCGATCAATCAGCGAGGCATGGATGATGAT
CACACATTACTCCCTCTGG*AGTCTGGACGATCGATCAAAAGACCACTTCAGCGTTGGCAAACTCCTCTCTCTTCTGGGCCATGTCTGGCACCATCTCAC
CGAACCTGCACGGTGGGCTGACCACCGGCACCGTGCCGTACGCATACTGTCCACCATGGCCGCGGCGAAGTCCAATGGCATGCACGTCCTTGGACTTCTG
TGCAATGATGACGGAGTTCACCACGTCATCATCCGGGTGGCACACGGCCAGCACCTCGAACCCGCCTCCGGCGATGTCTTGGGGGTCGACGATCGGGTAT
AGGAACCCGCGCGCCCCGTGCGCACTGCGCACGACCAGGGCCGCCCCATCTGCCATGTGTGCACC*GAGGTGCGCGATCACCTTGGCCTTGTCCTCGGCG
GCCATGCCCACAAGCGCGGCCAGGAAGACGACGTCGTACTTAGCGAGCTCGCCGGCGAGGTCCGCGACGTCGGGCCGTGTGGAACGACATGCGGGCGCCC
ACGTCCTTGTCCGCGCGGAACAGCTTGCTGGCGCGGTCATTGGCCGCGCCACAGAGGTCGTAGTTGTCGAACATGGTGTCGGGCAAGTGGCGTGCGGCAA
GGACGAAAGAGCTGAACGGCAAGTGGGCCAGAGCCGATGAAGGCGACGCGGGCCGGGGCGATGCCGCCGGGCACGTAGCGCGCCAGGAGCTCGTACTCGA
GCTTGCTGAGGTTGATGTAGTTGTTGTAGTAGGGGAACATGCCGAGGTGGTCGAGCGGGTTGTCGAAGGCCGCGAGCATGTCGGAGTAGTGCGCCTCCAG
CTTCCCCTCGGCCTCGGAGCAGAGGCGGATGAGTCCCTCCCGCATTTTCTGTGCCTCCGGGCCAAGCTTGGTCACGTCCACGGGGCTTGGTGGAACGCAC
GCGGTGACCAGCTCGGTGAAGAGCGCGTCGACGTCCGGGGACGGGCTGAGCGACGGCAGCTTGGCGATGGCGGCGTGGAGTCCGGTGATCTTTTGGACCA
GGGCATCCACCTCCTTGTT*CTGGgcagccatttttcgtgccttctaggtacctcaggcacaggagtggagtagagcctcgtgccgaa
page-top