Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig945  (registered. 2012)
Contig Information
Length 1136 bp
Clones alternative view 119 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_r Root 3
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 7
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 9
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 12
WH_XB Root 19
WH_XC Root, treated at 50 microM Al for 6h 10
WH_XD Root, treated at 50 microM Al for 6h 14
WH_XE Seedling, infected with leaf rust 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|9652119|gb|AAF91407.1|AF271362_1|AF271362_1 nucleoside diphosphate kinase [Lolium perenne]
Score 293
Evalue 3.00E-77
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig945
CTGCTACTAACCCACAAAAAAGTAGGGCAAAGAAATAATCAAAGCACGGCAAAAACATGAAATGCAACTCAATACCATATATCAAATATAGAGCAGCAGA
TAACGCTTGCATGCTCAAGCACAAGGAGATAACTTCAGTTCACACAAACAAGGTTCCCAAGATACAAATCTCAAAACTGTAAACAACCAAAGACTAGTTT
GGTAGATGCTTAATGAAACCTGCACTCAAACCACTCATGACACATCTTAGGCCTCATAGATCCAGTTGTGCTGGCTGCTCCTCCACTCTGCAATGCCCTC
AGGGAACCACAGGGCGATCTCCTTCCTGGCACTCTCAACTGAGTCGCTTCCATGGATGACGTTCCTGCCGATGTCGACGGCAAAGTCACCACGGATGGTG
CCGGGCTCAGAGGCCAGGGGGTTGGTGGCGCCAATGATCTTGCGTCCAGTGGCGACGACGCTCTTGCCCTCCCAGACCATAGCGACGACCGGGCCGGAGA
CGATGTACTCCACGAGCCCAGCGAAGAAGGGCTTGGAGGACAGATCGGAGTAGTGCTGCTCGGCGAACGACTTCTCCACGTTCTGGAGCTTCAGACCTTT
GAGGTAGAAGCCCTTCTTCTCGAAGCGGCTGATGACCTCGCCGATGAGGCCCCTCTGGACGCCGTCAGGCTTGATCATGATGAAGGTCTGCTCGGCCATT
GTTGCTGTGCTGAGCTTGAGATTTCTGATTCGGTTTTGACCCTCGTGCCGACCGACGACAAGAGAGTTTACGAGGTGCCGGCGATCAAGGTGGCAGCTCT
CAGGTTCACTGAGACGGCAAGGGCCCGCATTGTGAATGCCGGTGGAGAATGCCTCACCTTTGACCAGCTGGCCCTTCGTGCTCCTCTTGGCCAGAACACG
GTTCTCCTGAGGGGTCCAAAGAATGCCCGTGAGGCAGTGAGGCACTTCGGTAAGGCTCCTGGTGTGCCGCACAGCCATACCAAGCCTTATGTCCGCTCGA
AGGGAAGGAAGTTTGAGAAGGCAAGAGGAAGGAGGAACAGCAGAGGCTTCAAGGTCTAGGTTCTTGCTTGGTGTTCATGTGCTACACAGCTCTTGTTTGA
GTCTGAGTTATGTTATTATTAAGTGCTAGGATCATC
page-top