Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15624  (registered. 2007)
Contig Information
Length 649 bp
Clones 26 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 4
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 5
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Thalassiosira pseudonana CCMP1335]
Score 83
Evalue 1.52371
Total Hit Count 17
Registered year 2007
Contig Sequence     [ Download ]
>Contig15624
attcggcacgagggaGAGAAGGAAACCCTAG*CCGCCGCCGTCCAG*ATCTGCTTGGGTTGGTGGAGGTATGGCTACGGCGCTGCGCACCATGGCCGCGA
AGCTGATGCAGAAGATCCCCGCCGCTGTCCAGCGGGTTCGCGTCTCTTCTCGTGCTCCGGCACCGGCTTTTGCCGACCTCGACCCCTTCGGCCCAGAGTT
TCGCCGGGCACTGGAGAAGATTGTAGA*GAAACACAGGAAGAGGCGCAGGAACGAGGCCTTGGCCTGTGGTGCTGGCTTCAGTCTTGGAGCACTCACCTT
TTTGCTTGGGGTCCATCGGCTTCGTTGAAGGGAGATGGCTCAATGGTGAATGACTGGAATATCTATCCTGCACCGCATGTTCTACTATCTACTACTGTGC
CCGCAAGTTCTACTATCTACTAGTGCTATATCCTGCACCCCATATGTTCTGCTATCTACCAGTACTATATCCTGTATGTTTAACTAGCC*GGTGTACTCT
ATAATTCCTGGCTTGTGTCTACCTAT*CTAGTAGCCACTGTGGGGATCTAATTTCGGTGGTTGCATGTGGGATGTAAGAGCACT*CTATCGCCACTCTTA
T*CTGTTGTTATCAGAGATCTATATTCAGCCGtgttgttaaaaaaaaaa
page-top