Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15623  (registered. 2007)
Contig Information
Length 783 bp
Clones 26 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 11
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_24909 [Oryza sativa Indica Group]
Score 637
Evalue 1.27153e-64
Total Hit Count 478
Registered year 2007
Contig Sequence     [ Download ]
>Contig15623
ttttttttttgatattgCAAagagaAATATATTATTAGCTCTTGATGATTTACGC*TGAAGGCAGCAGCTGCCTGATAAACAAAGGTTCAG*AGGTCCAA
ATCGACGATATCTGCTAGGCTCACACTTGAAAGTTGG*AACAATAGGAAGCCCAAGAATAAAGCATAAATGAAACCGAGG*ACAAAAATGCCCAACCCAA
ATGTTTGCATCATGAAACATTCTCATCTAGTGAGACTTGACGTACTCCTGCACGATGTTAAGGCCCTCGGATTCTTCACCATAGTCCTTGACAACAACGC
AAGAGCAGCCCACAACCTTCCTTGCCTTGCCCTCAGAGTCAATCTTGCAAAGCCCTGCCCACTCTCCAAGAGTTTTAGCACTTGGCACAGTAACCAGGTG
AACATTGTGCTCAGCGCATAGTGCCTTAACGAGCTTCACGTAATCAGGCTGGTCACAATCCTCAGCCAGCACACAAAGCTGAGCAGCATGCTTCTCAATG
GACTTGGCAGCCTCACGGAGCCCCTTCACAAGGCCATCATGAGCACTTGACTTCTTCATGACAAGCTGTAGAGCAGTCATCAAGTCCATCGGCTCACCAA
GAACC*GGGG*TAGGTGCCTCTACTGGGGCAACAAC*T*GGTGTCGGGGCTTCTTCCGCCATCTCGTGCGCTCCAAAGGCCACCGAGGCAGCTGCGAAGG
AGGGAGAT*CTGGAG*CC*TTGGGACCTTGGAGAATGGAGAGCGGCGGCGGTAGGGTTTTCGCgagcctcgtgccgaattcct
page-top