Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9447  (registered. 2012)
Contig Information
Length 1028 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_KMP Shoot grown under continuous light 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125525016|gb|EAY73130.1|| hypothetical protein OsI_01005 [Oryza sativa Indica Group]
Score 298
Evalue 7.00E-79
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9447
TATCAAGAAAAAAATGCCTCACAACAATCTAATCTTTATTAAATCACCATTTACCGACGTTGGTTTTCCTCTCTGGCGTGACCAGTACACACGTCGTAAC
GAATTTAATAATGGAATCAATGTGGGGAAGCAGCGTCAAAAACTGAAGCTTACACATCCAACGCAAGAGAAGAGAGCTACACAAGTGTATATGATCAAGC
CACGTGGGAAATTTGTAAGAAAAAATAGACAAAATATATATTGGACCTCTTACACTTTCACTCGGTCGTATCACGAAGCTCTGTTCTGCTTCGTCTTGGC
GATGCTGAGAAGGTCGCCGAAGAGCTTGTCCTCGGGTTTCGACGGCCTCATGGGTTGCGCCATTGAGGATGAAGAGGGTGCTGCCTGATAGGTCGAGTTC
ATCCCCCCCATGTAGGAGCTGTCTTGCATGGAGAGACCATACATACTCTGAGAGAGGCCGTTGGTACCAGGGTACCCATACATTGCTGGCCTTCCCTGGT
TGTAGTACTGTGCTGCTTGCTGCTGCACATAACCGTACTGCGTCGCCATCCGACCACCACCGCCGTACATCTGCTGTTGTGGCATTCCTCCAAACTGCGC
CCCCGGCATTGGTTGCGCATACATCATGCCTGGCTGCGCTCCTGGCATCGGCGACGGTTGCATACCAGCGAACTGCATGCCTGGCATTGGCATGGGTTGT
GGTGCCAAATGTCCATACTGGTTTCCATAACCTGGCTGCATCTGCCCTCCAACAGTTTGGTTGGACTGCATTGCGTGAGGTACCATAGCTCCTGGTTGGT
TGTTATACATTGGCTGCGGTTGTAGACCTGCCATGTGGTTGTTCTGCGGTTGTAGTGGCTGCACACCACCGAATTGGCTTGCTGGAGGTGGGAGAGGTTG
CATACCACCCAATTGGCCATTTGGCATTTCATTGCTTGGCGCTGCGGGAGCCTCCCAAGGTGGAGGCGGAAGGGCTCCACTTTGATCATCATAATTTACT
TGCTGTGGTGGGGGTGCTGCATGGTTGG
page-top